Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631917_at:

>probe:Drosophila_2:1631917_at:372:561; Interrogation_Position=2100; Antisense; GGAACTCCGGGTCATAACCAGCTCG
>probe:Drosophila_2:1631917_at:148:445; Interrogation_Position=2160; Antisense; GATGAGCAAGTCGAACAGTTCACTA
>probe:Drosophila_2:1631917_at:97:187; Interrogation_Position=2173; Antisense; AACAGTTCACTAGGTTCCGTGACCA
>probe:Drosophila_2:1631917_at:208:589; Interrogation_Position=2261; Antisense; TGGATAGCTTTCAGGCCATGGCCGA
>probe:Drosophila_2:1631917_at:533:393; Interrogation_Position=2298; Antisense; GAAAGGTTCCTACGACTATCTGCGC
>probe:Drosophila_2:1631917_at:469:147; Interrogation_Position=2312; Antisense; ACTATCTGCGCAAGTGCTCGGAGGC
>probe:Drosophila_2:1631917_at:426:623; Interrogation_Position=2339; Antisense; TGCGTCAGCATTCGCTGCAACTGAA
>probe:Drosophila_2:1631917_at:615:95; Interrogation_Position=2447; Antisense; AGATTCAGAATGGTTTCGCTAGCGA
>probe:Drosophila_2:1631917_at:201:485; Interrogation_Position=2504; Antisense; GTAGCATCCGCGAGGCGGTCCAGAA
>probe:Drosophila_2:1631917_at:633:175; Interrogation_Position=2547; Antisense; AAACGGTTTCCAGATCCTCGACGAT
>probe:Drosophila_2:1631917_at:543:269; Interrogation_Position=2574; Antisense; CATGCGGCTGTTTATCGATATTATT
>probe:Drosophila_2:1631917_at:676:261; Interrogation_Position=2601; Antisense; CAGCCAGGATCGATTGAGTCAGGGT
>probe:Drosophila_2:1631917_at:353:427; Interrogation_Position=2616; Antisense; GAGTCAGGGTATGTACACCCTCTTC
>probe:Drosophila_2:1631917_at:713:259; Interrogation_Position=2631; Antisense; CACCCTCTTCCGTAAAATTGCAATT

Paste this into a BLAST search page for me
GGAACTCCGGGTCATAACCAGCTCGGATGAGCAAGTCGAACAGTTCACTAAACAGTTCACTAGGTTCCGTGACCATGGATAGCTTTCAGGCCATGGCCGAGAAAGGTTCCTACGACTATCTGCGCACTATCTGCGCAAGTGCTCGGAGGCTGCGTCAGCATTCGCTGCAACTGAAAGATTCAGAATGGTTTCGCTAGCGAGTAGCATCCGCGAGGCGGTCCAGAAAAACGGTTTCCAGATCCTCGACGATCATGCGGCTGTTTATCGATATTATTCAGCCAGGATCGATTGAGTCAGGGTGAGTCAGGGTATGTACACCCTCTTCCACCCTCTTCCGTAAAATTGCAATT

Full Affymetrix probeset data:

Annotations for 1631917_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime