Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631919_at:

>probe:Drosophila_2:1631919_at:61:701; Interrogation_Position=1232; Antisense; TTTTTGACAAGGCTGTGCTGTACCA
>probe:Drosophila_2:1631919_at:664:277; Interrogation_Position=1260; Antisense; CTTTGAGCTGCTTATGTCCATCGAT
>probe:Drosophila_2:1631919_at:239:379; Interrogation_Position=1299; Antisense; GAAGCGCTTGGCTACCGAAAAGGAT
>probe:Drosophila_2:1631919_at:415:533; Interrogation_Position=1320; Antisense; GGATCGCTTTTTCAGGTTCTTTAAG
>probe:Drosophila_2:1631919_at:201:375; Interrogation_Position=1359; Antisense; GAAGATCAGCTCTTTGGACGAGACC
>probe:Drosophila_2:1631919_at:447:553; Interrogation_Position=1374; Antisense; GGACGAGACCAACGCTAATTTCCTG
>probe:Drosophila_2:1631919_at:272:655; Interrogation_Position=1389; Antisense; TAATTTCCTGCGTGGCATAGCGTAC
>probe:Drosophila_2:1631919_at:629:403; Interrogation_Position=1432; Antisense; GACTACATTTTCAAGCACCTCGAGA
>probe:Drosophila_2:1631919_at:336:521; Interrogation_Position=1513; Antisense; GTGGCTCTAGTCAATTCACCCATAA
>probe:Drosophila_2:1631919_at:262:577; Interrogation_Position=1641; Antisense; GGCCCAGTTAATCTGCTACTACTAT
>probe:Drosophila_2:1631919_at:413:705; Interrogation_Position=1712; Antisense; TTATCGTCGTTTACTTTCTGCAGCA
>probe:Drosophila_2:1631919_at:726:449; Interrogation_Position=1754; Antisense; GATCGGCCAAAAAGTCTGTGACCAC
>probe:Drosophila_2:1631919_at:660:195; Interrogation_Position=1780; Antisense; AACGGCAAGTTTAACCACCTCATCG
>probe:Drosophila_2:1631919_at:654:45; Interrogation_Position=1801; Antisense; ATCGCCAAGCTTGCCAATGTACATG

Paste this into a BLAST search page for me
TTTTTGACAAGGCTGTGCTGTACCACTTTGAGCTGCTTATGTCCATCGATGAAGCGCTTGGCTACCGAAAAGGATGGATCGCTTTTTCAGGTTCTTTAAGGAAGATCAGCTCTTTGGACGAGACCGGACGAGACCAACGCTAATTTCCTGTAATTTCCTGCGTGGCATAGCGTACGACTACATTTTCAAGCACCTCGAGAGTGGCTCTAGTCAATTCACCCATAAGGCCCAGTTAATCTGCTACTACTATTTATCGTCGTTTACTTTCTGCAGCAGATCGGCCAAAAAGTCTGTGACCACAACGGCAAGTTTAACCACCTCATCGATCGCCAAGCTTGCCAATGTACATG

Full Affymetrix probeset data:

Annotations for 1631919_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime