FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631921_at:

>probe:Drosophila_2:1631921_at:209:193; Interrogation_Position=118; Antisense; AACTCGCAGGCGCACCTTCATAAGT
>probe:Drosophila_2:1631921_at:180:349; Interrogation_Position=123; Antisense; GCAGGCGCACCTTCATAAGTGCCAG
>probe:Drosophila_2:1631921_at:649:57; Interrogation_Position=13; Antisense; ATGTGCAACGACTCCACTGAGCCGG
>probe:Drosophila_2:1631921_at:672:657; Interrogation_Position=138; Antisense; TAAGTGCCAGCCCAACACCGGATTC
>probe:Drosophila_2:1631921_at:118:131; Interrogation_Position=154; Antisense; ACCGGATTCGATCAGGACCTCAACG
>probe:Drosophila_2:1631921_at:407:413; Interrogation_Position=169; Antisense; GACCTCAACGCCTGTGTGCCATGGA
>probe:Drosophila_2:1631921_at:589:305; Interrogation_Position=179; Antisense; CCTGTGTGCCATGGACCGCCTGGGA
>probe:Drosophila_2:1631921_at:344:133; Interrogation_Position=193; Antisense; ACCGCCTGGGAGTGGAAGCCATGCC
>probe:Drosophila_2:1631921_at:129:137; Interrogation_Position=20; Antisense; ACGACTCCACTGAGCCGGGATGCCT
>probe:Drosophila_2:1631921_at:402:83; Interrogation_Position=203; Antisense; AGTGGAAGCCATGCCAGGAGCCGCC
>probe:Drosophila_2:1631921_at:325:267; Interrogation_Position=228; Antisense; CAGTCGTCCTCCTGGATGGAGTGGA
>probe:Drosophila_2:1631921_at:115:263; Interrogation_Position=70; Antisense; CAGCGTTATTGTTTGGACCCCACCA
>probe:Drosophila_2:1631921_at:88:481; Interrogation_Position=80; Antisense; GTTTGGACCCCACCAAGTACTGGCT
>probe:Drosophila_2:1631921_at:444:89; Interrogation_Position=95; Antisense; AGTACTGGCTCTGCAGCGCCATCAA

Paste this into a BLAST search page for me
AACTCGCAGGCGCACCTTCATAAGTGCAGGCGCACCTTCATAAGTGCCAGATGTGCAACGACTCCACTGAGCCGGTAAGTGCCAGCCCAACACCGGATTCACCGGATTCGATCAGGACCTCAACGGACCTCAACGCCTGTGTGCCATGGACCTGTGTGCCATGGACCGCCTGGGAACCGCCTGGGAGTGGAAGCCATGCCACGACTCCACTGAGCCGGGATGCCTAGTGGAAGCCATGCCAGGAGCCGCCCAGTCGTCCTCCTGGATGGAGTGGACAGCGTTATTGTTTGGACCCCACCAGTTTGGACCCCACCAAGTACTGGCTAGTACTGGCTCTGCAGCGCCATCAA

Full Affymetrix probeset data:

Annotations for 1631921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720