FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631925_at:

>probe:Drosophila_2:1631925_at:81:525; Interrogation_Position=3551; Antisense; GGGCATAGTCTCTCAAGAACCCACT
>probe:Drosophila_2:1631925_at:44:645; Interrogation_Position=3577; Antisense; TCTTCGAGCGCTCTATAGCCGAAAA
>probe:Drosophila_2:1631925_at:646:673; Interrogation_Position=3604; Antisense; TAGCCTATGGCGACAATCGGCGATC
>probe:Drosophila_2:1631925_at:424:41; Interrogation_Position=3619; Antisense; ATCGGCGATCTGTTTCCATGGTGGA
>probe:Drosophila_2:1631925_at:609:353; Interrogation_Position=3654; Antisense; GCAGCCAAGAGTGCCAATGCTCATA
>probe:Drosophila_2:1631925_at:343:435; Interrogation_Position=3727; Antisense; GAGGTACTCAGCTATCTGGTGGACA
>probe:Drosophila_2:1631925_at:387:215; Interrogation_Position=3795; Antisense; AAGATCCTGCTACTCGACGAAGCCA
>probe:Drosophila_2:1631925_at:669:151; Interrogation_Position=3845; Antisense; ACAGTTGGTCCAACAGGCCTTGGAT
>probe:Drosophila_2:1631925_at:479:527; Interrogation_Position=3881; Antisense; GGGACGCACCTGTATTGTCATAGCC
>probe:Drosophila_2:1631925_at:259:647; Interrogation_Position=3898; Antisense; TCATAGCCCATCGATTGTCAACTGT
>probe:Drosophila_2:1631925_at:269:599; Interrogation_Position=3913; Antisense; TGTCAACTGTCCAGAATGCCGATGT
>probe:Drosophila_2:1631925_at:442:529; Interrogation_Position=3974; Antisense; GGGTAACCACATGCAGTTGATTTCA
>probe:Drosophila_2:1631925_at:14:469; Interrogation_Position=3989; Antisense; GTTGATTTCACAGGGCGGCATTTAC
>probe:Drosophila_2:1631925_at:548:569; Interrogation_Position=4005; Antisense; GGCATTTACGCCAAGCTACACAAGA

Paste this into a BLAST search page for me
GGGCATAGTCTCTCAAGAACCCACTTCTTCGAGCGCTCTATAGCCGAAAATAGCCTATGGCGACAATCGGCGATCATCGGCGATCTGTTTCCATGGTGGAGCAGCCAAGAGTGCCAATGCTCATAGAGGTACTCAGCTATCTGGTGGACAAAGATCCTGCTACTCGACGAAGCCAACAGTTGGTCCAACAGGCCTTGGATGGGACGCACCTGTATTGTCATAGCCTCATAGCCCATCGATTGTCAACTGTTGTCAACTGTCCAGAATGCCGATGTGGGTAACCACATGCAGTTGATTTCAGTTGATTTCACAGGGCGGCATTTACGGCATTTACGCCAAGCTACACAAGA

Full Affymetrix probeset data:

Annotations for 1631925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720