FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631933_at:

>probe:Drosophila_2:1631933_at:316:481; Interrogation_Position=2108; Antisense; GTTTGTCCAAGTCAAGGGCGACGTT
>probe:Drosophila_2:1631933_at:541:523; Interrogation_Position=2123; Antisense; GGGCGACGTTATTTGCTTGCATAGG
>probe:Drosophila_2:1631933_at:575:91; Interrogation_Position=2174; Antisense; AGTATAGTCGCACGTCGAGGACGCA
>probe:Drosophila_2:1631933_at:702:499; Interrogation_Position=2187; Antisense; GTCGAGGACGCACTTAAATTTTTGT
>probe:Drosophila_2:1631933_at:489:519; Interrogation_Position=2284; Antisense; GTGGTTATTTGATCCGTACAGCGAT
>probe:Drosophila_2:1631933_at:154:167; Interrogation_Position=2309; Antisense; AAATGGCCTACGATGGTGAACCGTT
>probe:Drosophila_2:1631933_at:581:709; Interrogation_Position=2391; Antisense; TTAATTCACACACGCAGTTATCGGA
>probe:Drosophila_2:1631933_at:568:465; Interrogation_Position=2442; Antisense; GTTTTGCGTTACTTACACCTAGGCT
>probe:Drosophila_2:1631933_at:28:3; Interrogation_Position=2453; Antisense; CTTACACCTAGGCTACTACAGACTT
>probe:Drosophila_2:1631933_at:322:341; Interrogation_Position=2496; Antisense; GCATAATTCGAATACTCGGCCCGAA
>probe:Drosophila_2:1631933_at:586:667; Interrogation_Position=2508; Antisense; TACTCGGCCCGAAGACAAACTAAAT
>probe:Drosophila_2:1631933_at:392:581; Interrogation_Position=2572; Antisense; TGGCTTGTTTCTATTTCTCGCTTAA
>probe:Drosophila_2:1631933_at:599:7; Interrogation_Position=2639; Antisense; ATTGCTTGGTATTTTACGCTTGGTA
>probe:Drosophila_2:1631933_at:89:17; Interrogation_Position=2675; Antisense; ATTTTGTATGTTGTCCGTGTGCTGC

Paste this into a BLAST search page for me
GTTTGTCCAAGTCAAGGGCGACGTTGGGCGACGTTATTTGCTTGCATAGGAGTATAGTCGCACGTCGAGGACGCAGTCGAGGACGCACTTAAATTTTTGTGTGGTTATTTGATCCGTACAGCGATAAATGGCCTACGATGGTGAACCGTTTTAATTCACACACGCAGTTATCGGAGTTTTGCGTTACTTACACCTAGGCTCTTACACCTAGGCTACTACAGACTTGCATAATTCGAATACTCGGCCCGAATACTCGGCCCGAAGACAAACTAAATTGGCTTGTTTCTATTTCTCGCTTAAATTGCTTGGTATTTTACGCTTGGTAATTTTGTATGTTGTCCGTGTGCTGC

Full Affymetrix probeset data:

Annotations for 1631933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720