FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631935_at:

>probe:Drosophila_2:1631935_at:287:465; Interrogation_Position=399; Antisense; GTTGGTAGGAATCGAGTCCCTGCCC
>probe:Drosophila_2:1631935_at:367:83; Interrogation_Position=443; Antisense; AGGGCTTCTCTATGCCAGATCACAT
>probe:Drosophila_2:1631935_at:572:257; Interrogation_Position=469; Antisense; CACAGTATCTACTTGGATCCCAATG
>probe:Drosophila_2:1631935_at:479:45; Interrogation_Position=485; Antisense; ATCCCAATGTGGGTGCTGTGGTCGT
>probe:Drosophila_2:1631935_at:138:335; Interrogation_Position=540; Antisense; GCTGACAAAGGCGTGTTGCTATCTC
>probe:Drosophila_2:1631935_at:103:693; Interrogation_Position=583; Antisense; TTTGTGGCCACAAGTCGCGATGCGG
>probe:Drosophila_2:1631935_at:364:11; Interrogation_Position=664; Antisense; ATTCAGGCGGCCAGTCAACGTATGC
>probe:Drosophila_2:1631935_at:233:197; Interrogation_Position=680; Antisense; AACGTATGCCCTTCACTTGTGGAAA
>probe:Drosophila_2:1631935_at:149:183; Interrogation_Position=702; Antisense; AAAACCCAATCCGTACATGTGCATC
>probe:Drosophila_2:1631935_at:717:475; Interrogation_Position=745; Antisense; GTTATTCAGCCGGACAGGACTTTGA
>probe:Drosophila_2:1631935_at:168:63; Interrogation_Position=784; Antisense; ATGTGCACAGATATCCTTTTGGGCT
>probe:Drosophila_2:1631935_at:608:529; Interrogation_Position=845; Antisense; GGGTTAACAGCTATCAGGATGCCAT
>probe:Drosophila_2:1631935_at:268:437; Interrogation_Position=871; Antisense; GAGGCTCAGGGATCTAAGGCTCCAT
>probe:Drosophila_2:1631935_at:543:39; Interrogation_Position=941; Antisense; ATCTGTTGCCATTTTTATCTTCTCG

Paste this into a BLAST search page for me
GTTGGTAGGAATCGAGTCCCTGCCCAGGGCTTCTCTATGCCAGATCACATCACAGTATCTACTTGGATCCCAATGATCCCAATGTGGGTGCTGTGGTCGTGCTGACAAAGGCGTGTTGCTATCTCTTTGTGGCCACAAGTCGCGATGCGGATTCAGGCGGCCAGTCAACGTATGCAACGTATGCCCTTCACTTGTGGAAAAAAACCCAATCCGTACATGTGCATCGTTATTCAGCCGGACAGGACTTTGAATGTGCACAGATATCCTTTTGGGCTGGGTTAACAGCTATCAGGATGCCATGAGGCTCAGGGATCTAAGGCTCCATATCTGTTGCCATTTTTATCTTCTCG

Full Affymetrix probeset data:

Annotations for 1631935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720