Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631937_at:

>probe:Drosophila_2:1631937_at:210:683; Interrogation_Position=3887; Antisense; TATCCTCCTCTACCAATTCTTTAAA
>probe:Drosophila_2:1631937_at:404:457; Interrogation_Position=3924; Antisense; GATAGTGGTTGGTCCCCAAGATCCT
>probe:Drosophila_2:1631937_at:668:363; Interrogation_Position=4029; Antisense; GACACTAACCCATATCGAACTTGTT
>probe:Drosophila_2:1631937_at:473:541; Interrogation_Position=4113; Antisense; GGTTAATGAGACGACACCTCCACAA
>probe:Drosophila_2:1631937_at:157:449; Interrogation_Position=4170; Antisense; GATCGACTCGGTGAAGCAACACGGT
>probe:Drosophila_2:1631937_at:725:607; Interrogation_Position=4214; Antisense; TGACCAAGGTGGGTCTACTCTTCCA
>probe:Drosophila_2:1631937_at:488:275; Interrogation_Position=4249; Antisense; CTTCTCAACTCGCTCTATGTTCAAA
>probe:Drosophila_2:1631937_at:43:179; Interrogation_Position=4273; Antisense; AAACATGCTCACTGGCTGATCTACG
>probe:Drosophila_2:1631937_at:613:603; Interrogation_Position=4289; Antisense; TGATCTACGATTCGGAGCGTTCCCA
>probe:Drosophila_2:1631937_at:622:65; Interrogation_Position=4313; Antisense; ATGGACCTCCACCATCATTTGGTTT
>probe:Drosophila_2:1631937_at:467:271; Interrogation_Position=4325; Antisense; CATCATTTGGTTTGGTCCTTTGGGA
>probe:Drosophila_2:1631937_at:249:277; Interrogation_Position=4342; Antisense; CTTTGGGAAGGGTACTTGACGCACA
>probe:Drosophila_2:1631937_at:719:101; Interrogation_Position=4376; Antisense; AGAGCTACTCCGATTCTGAGAGCAG
>probe:Drosophila_2:1631937_at:351:425; Interrogation_Position=4393; Antisense; GAGAGCAGTGAGTTCAGTTCCACCC

Paste this into a BLAST search page for me
TATCCTCCTCTACCAATTCTTTAAAGATAGTGGTTGGTCCCCAAGATCCTGACACTAACCCATATCGAACTTGTTGGTTAATGAGACGACACCTCCACAAGATCGACTCGGTGAAGCAACACGGTTGACCAAGGTGGGTCTACTCTTCCACTTCTCAACTCGCTCTATGTTCAAAAAACATGCTCACTGGCTGATCTACGTGATCTACGATTCGGAGCGTTCCCAATGGACCTCCACCATCATTTGGTTTCATCATTTGGTTTGGTCCTTTGGGACTTTGGGAAGGGTACTTGACGCACAAGAGCTACTCCGATTCTGAGAGCAGGAGAGCAGTGAGTTCAGTTCCACCC

Full Affymetrix probeset data:

Annotations for 1631937_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime