Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631942_at:

>probe:Drosophila_2:1631942_at:46:565; Interrogation_Position=5743; Antisense; GGAATGGATGCTGGCGCCAACTTGA
>probe:Drosophila_2:1631942_at:672:677; Interrogation_Position=5768; Antisense; TAGAGGCACTCTTCCAGGCAAACAA
>probe:Drosophila_2:1631942_at:665:157; Interrogation_Position=5789; Antisense; ACAACTCGGTGGTGGATCACTCGGT
>probe:Drosophila_2:1631942_at:104:33; Interrogation_Position=5804; Antisense; ATCACTCGGTGAAGTCGTCGGACCA
>probe:Drosophila_2:1631942_at:184:373; Interrogation_Position=5814; Antisense; GAAGTCGTCGGACCATATGCACGGC
>probe:Drosophila_2:1631942_at:511:617; Interrogation_Position=5831; Antisense; TGCACGGCCTGCTGTACAACAATTT
>probe:Drosophila_2:1631942_at:421:383; Interrogation_Position=5881; Antisense; GAACTGGACCTGTTCCAGGCGATGG
>probe:Drosophila_2:1631942_at:144:355; Interrogation_Position=5919; Antisense; GCACTCGGAGGCAGCTAATCATCAC
>probe:Drosophila_2:1631942_at:584:359; Interrogation_Position=5965; Antisense; GCAACCACCTATGCGGCTGTGCTGA
>probe:Drosophila_2:1631942_at:501:559; Interrogation_Position=6025; Antisense; GGAACAGGACCATCGCCGGGACAGT
>probe:Drosophila_2:1631942_at:321:317; Interrogation_Position=6099; Antisense; GCCGGCGGTTGGTCGTAACGATCTT
>probe:Drosophila_2:1631942_at:683:549; Interrogation_Position=6126; Antisense; GGAGAAGGATCCGTTTGCGGCCATC
>probe:Drosophila_2:1631942_at:39:307; Interrogation_Position=6167; Antisense; CCACGACCGGATTCTACAACTATTT
>probe:Drosophila_2:1631942_at:551:263; Interrogation_Position=6226; Antisense; CAGCTGTGGCATCAAAGGGTCATAT

Paste this into a BLAST search page for me
GGAATGGATGCTGGCGCCAACTTGATAGAGGCACTCTTCCAGGCAAACAAACAACTCGGTGGTGGATCACTCGGTATCACTCGGTGAAGTCGTCGGACCAGAAGTCGTCGGACCATATGCACGGCTGCACGGCCTGCTGTACAACAATTTGAACTGGACCTGTTCCAGGCGATGGGCACTCGGAGGCAGCTAATCATCACGCAACCACCTATGCGGCTGTGCTGAGGAACAGGACCATCGCCGGGACAGTGCCGGCGGTTGGTCGTAACGATCTTGGAGAAGGATCCGTTTGCGGCCATCCCACGACCGGATTCTACAACTATTTCAGCTGTGGCATCAAAGGGTCATAT

Full Affymetrix probeset data:

Annotations for 1631942_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime