Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631946_at:

>probe:Drosophila_2:1631946_at:385:127; Interrogation_Position=1579; Antisense; ACCAGGCAGGTCAGGATGTCTTCGT
>probe:Drosophila_2:1631946_at:108:61; Interrogation_Position=1594; Antisense; ATGTCTTCGTTGTCAAGTCCGACGG
>probe:Drosophila_2:1631946_at:551:201; Interrogation_Position=1624; Antisense; AAGCCGTTAAGCATGTGGTCTCTAC
>probe:Drosophila_2:1631946_at:334:641; Interrogation_Position=1733; Antisense; TCTGCGATTCGAGTTCACCGAGCAA
>probe:Drosophila_2:1631946_at:600:545; Interrogation_Position=1770; Antisense; GGATCGATGAAGTACACCCAAGCCC
>probe:Drosophila_2:1631946_at:124:299; Interrogation_Position=1794; Antisense; CCGCAAGCCAATCAGTACTACTACG
>probe:Drosophila_2:1631946_at:548:661; Interrogation_Position=1809; Antisense; TACTACTACGAAACCGTGGCCCAAG
>probe:Drosophila_2:1631946_at:461:465; Interrogation_Position=1868; Antisense; GATTGAACTCAGCAAGCCCATTAAG
>probe:Drosophila_2:1631946_at:448:563; Interrogation_Position=1892; Antisense; GGAATACACCGATGACCCAGAGGAT
>probe:Drosophila_2:1631946_at:199:171; Interrogation_Position=1955; Antisense; AAAGGTGCCCACTGTGACGAGTTCA
>probe:Drosophila_2:1631946_at:642:409; Interrogation_Position=1970; Antisense; GACGAGTTCAGCTACTCCTGACGAT
>probe:Drosophila_2:1631946_at:221:241; Interrogation_Position=2057; Antisense; AATAATCTGTGGATCCGACGGATAC
>probe:Drosophila_2:1631946_at:99:663; Interrogation_Position=2085; Antisense; TACACGGGCGAAACCCAACTGCAGT
>probe:Drosophila_2:1631946_at:516:509; Interrogation_Position=2108; Antisense; GTGCTATTCGTCATGCCTCAATATA

Paste this into a BLAST search page for me
ACCAGGCAGGTCAGGATGTCTTCGTATGTCTTCGTTGTCAAGTCCGACGGAAGCCGTTAAGCATGTGGTCTCTACTCTGCGATTCGAGTTCACCGAGCAAGGATCGATGAAGTACACCCAAGCCCCCGCAAGCCAATCAGTACTACTACGTACTACTACGAAACCGTGGCCCAAGGATTGAACTCAGCAAGCCCATTAAGGGAATACACCGATGACCCAGAGGATAAAGGTGCCCACTGTGACGAGTTCAGACGAGTTCAGCTACTCCTGACGATAATAATCTGTGGATCCGACGGATACTACACGGGCGAAACCCAACTGCAGTGTGCTATTCGTCATGCCTCAATATA

Full Affymetrix probeset data:

Annotations for 1631946_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime