Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631950_at:

>probe:Drosophila_2:1631950_at:326:635; Interrogation_Position=1501; Antisense; TCGCGTCTGCCCTACGAGATATAAG
>probe:Drosophila_2:1631950_at:601:427; Interrogation_Position=1516; Antisense; GAGATATAAGCTCCCTAGCCACCGG
>probe:Drosophila_2:1631950_at:541:673; Interrogation_Position=1531; Antisense; TAGCCACCGGAGGTCCTACAAGATT
>probe:Drosophila_2:1631950_at:157:665; Interrogation_Position=1547; Antisense; TACAAGATTCCCGTTCGGCAGTAGA
>probe:Drosophila_2:1631950_at:604:99; Interrogation_Position=1569; Antisense; AGAGGCTCCCCAGGCTATATAGATT
>probe:Drosophila_2:1631950_at:666:163; Interrogation_Position=1630; Antisense; AAATACGTTCCGTTGCTGAGCTCAG
>probe:Drosophila_2:1631950_at:136:415; Interrogation_Position=1659; Antisense; GACCACCTACCGCTTATAGATGCAA
>probe:Drosophila_2:1631950_at:311:155; Interrogation_Position=1683; Antisense; ACAGCTACAGCTTATCTCAAGATGG
>probe:Drosophila_2:1631950_at:525:699; Interrogation_Position=1740; Antisense; TTTTTTATTGTTCACCTCGCGGAGC
>probe:Drosophila_2:1631950_at:570:635; Interrogation_Position=1756; Antisense; TCGCGGAGCTATTCCAGCCACTGAA
>probe:Drosophila_2:1631950_at:701:265; Interrogation_Position=1787; Antisense; CAGTCCCCAGGATGTTGACGCGAAT
>probe:Drosophila_2:1631950_at:12:505; Interrogation_Position=1955; Antisense; GTCCGCTGCTTTATTACCTGTACAG
>probe:Drosophila_2:1631950_at:542:665; Interrogation_Position=1981; Antisense; TACAACATGACACGTTAGCCTACCC
>probe:Drosophila_2:1631950_at:729:137; Interrogation_Position=2009; Antisense; ACGTCAATGCATAGTGGTTCACCCA

Paste this into a BLAST search page for me
TCGCGTCTGCCCTACGAGATATAAGGAGATATAAGCTCCCTAGCCACCGGTAGCCACCGGAGGTCCTACAAGATTTACAAGATTCCCGTTCGGCAGTAGAAGAGGCTCCCCAGGCTATATAGATTAAATACGTTCCGTTGCTGAGCTCAGGACCACCTACCGCTTATAGATGCAAACAGCTACAGCTTATCTCAAGATGGTTTTTTATTGTTCACCTCGCGGAGCTCGCGGAGCTATTCCAGCCACTGAACAGTCCCCAGGATGTTGACGCGAATGTCCGCTGCTTTATTACCTGTACAGTACAACATGACACGTTAGCCTACCCACGTCAATGCATAGTGGTTCACCCA

Full Affymetrix probeset data:

Annotations for 1631950_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime