FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631953_at:

>probe:Drosophila_2:1631953_at:98:291; Interrogation_Position=1075; Antisense; CGGATGTTCCAGTTGGGCGTGATCA
>probe:Drosophila_2:1631953_at:174:329; Interrogation_Position=1091; Antisense; GCGTGATCAGTTACGGCCGAGCCTG
>probe:Drosophila_2:1631953_at:69:127; Interrogation_Position=1121; Antisense; AGCCTTTTGGCATCGGTGTCAACAC
>probe:Drosophila_2:1631953_at:169:131; Interrogation_Position=1160; Antisense; ACCTCAACTGGCTGTGGCGCTATAT
>probe:Drosophila_2:1631953_at:629:259; Interrogation_Position=660; Antisense; CACGGGTGCCGAATCAATCTATGCG
>probe:Drosophila_2:1631953_at:336:623; Interrogation_Position=681; Antisense; TGCGGCGCAGTATCGCATCCAAAAT
>probe:Drosophila_2:1631953_at:374:167; Interrogation_Position=750; Antisense; AAATGACATAGCCTTGCTCCAGACG
>probe:Drosophila_2:1631953_at:98:83; Interrogation_Position=778; Antisense; ACCCCAATTGAATGGTCCCGCGGAG
>probe:Drosophila_2:1631953_at:390:681; Interrogation_Position=812; Antisense; TATGTCTTCCCATTAGACAGGCGGA
>probe:Drosophila_2:1631953_at:93:387; Interrogation_Position=837; Antisense; GAACAGCTTCAACTACCAGAACGTG
>probe:Drosophila_2:1631953_at:18:185; Interrogation_Position=917; Antisense; AAAAGGCCACACTGCTGACCATGGA
>probe:Drosophila_2:1631953_at:409:67; Interrogation_Position=937; Antisense; ATGGACAATGCCGTCTGCCGGAGTC
>probe:Drosophila_2:1631953_at:589:431; Interrogation_Position=957; Antisense; GAGTCGCTTCAACTCCAGCATAACT
>probe:Drosophila_2:1631953_at:6:287; Interrogation_Position=991; Antisense; CTGTGCACGTACGATGCTGGCGGCA

Paste this into a BLAST search page for me
CGGATGTTCCAGTTGGGCGTGATCAGCGTGATCAGTTACGGCCGAGCCTGAGCCTTTTGGCATCGGTGTCAACACACCTCAACTGGCTGTGGCGCTATATCACGGGTGCCGAATCAATCTATGCGTGCGGCGCAGTATCGCATCCAAAATAAATGACATAGCCTTGCTCCAGACGACCCCAATTGAATGGTCCCGCGGAGTATGTCTTCCCATTAGACAGGCGGAGAACAGCTTCAACTACCAGAACGTGAAAAGGCCACACTGCTGACCATGGAATGGACAATGCCGTCTGCCGGAGTCGAGTCGCTTCAACTCCAGCATAACTCTGTGCACGTACGATGCTGGCGGCA

Full Affymetrix probeset data:

Annotations for 1631953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720