FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631954_at:

>probe:Drosophila_2:1631954_at:530:393; Interrogation_Position=2724; Antisense; GAAAGGTCACCACCATGGCTCTGTG
>probe:Drosophila_2:1631954_at:62:121; Interrogation_Position=2751; Antisense; AGCTGTTCGAGTATGGTGTTGCCAC
>probe:Drosophila_2:1631954_at:240:717; Interrogation_Position=2769; Antisense; TTGCCACTCAGGACAACCGTTTGAC
>probe:Drosophila_2:1631954_at:514:103; Interrogation_Position=2840; Antisense; AGACGTACTCGATCCGTGGCAGCTA
>probe:Drosophila_2:1631954_at:429:221; Interrogation_Position=2873; Antisense; AAGTGGGTAACAATTCCGGCTCTCG
>probe:Drosophila_2:1631954_at:62:571; Interrogation_Position=2890; Antisense; GGCTCTCGTCAAGATCTTCAAGGTT
>probe:Drosophila_2:1631954_at:630:221; Interrogation_Position=2909; Antisense; AAGGTTTTGATCTCCGAGTACCAGC
>probe:Drosophila_2:1631954_at:133:431; Interrogation_Position=2924; Antisense; GAGTACCAGCACTTCCAGGAGGGCA
>probe:Drosophila_2:1631954_at:229:409; Interrogation_Position=2954; Antisense; GACGAACCTCTTACGGACAGCGAAG
>probe:Drosophila_2:1631954_at:598:559; Interrogation_Position=3013; Antisense; GGACAAGCCGCGTTACATATCCGAT
>probe:Drosophila_2:1631954_at:376:23; Interrogation_Position=3029; Antisense; ATATCCGATCTGTTCGAATCTGACG
>probe:Drosophila_2:1631954_at:544:559; Interrogation_Position=3097; Antisense; GGAAACCAACTACCAGGGCGACATA
>probe:Drosophila_2:1631954_at:9:697; Interrogation_Position=3178; Antisense; TTTCTATGAACACCTCACCGAGGGT
>probe:Drosophila_2:1631954_at:157:455; Interrogation_Position=3242; Antisense; GATAACCTCTCCTTATTCGTATTGT

Paste this into a BLAST search page for me
GAAAGGTCACCACCATGGCTCTGTGAGCTGTTCGAGTATGGTGTTGCCACTTGCCACTCAGGACAACCGTTTGACAGACGTACTCGATCCGTGGCAGCTAAAGTGGGTAACAATTCCGGCTCTCGGGCTCTCGTCAAGATCTTCAAGGTTAAGGTTTTGATCTCCGAGTACCAGCGAGTACCAGCACTTCCAGGAGGGCAGACGAACCTCTTACGGACAGCGAAGGGACAAGCCGCGTTACATATCCGATATATCCGATCTGTTCGAATCTGACGGGAAACCAACTACCAGGGCGACATATTTCTATGAACACCTCACCGAGGGTGATAACCTCTCCTTATTCGTATTGT

Full Affymetrix probeset data:

Annotations for 1631954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720