FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631956_at:

>probe:Drosophila_2:1631956_at:610:359; Interrogation_Position=1069; Antisense; GCAACTTCTTTACAGGATCAGCGAT
>probe:Drosophila_2:1631956_at:228:577; Interrogation_Position=1094; Antisense; TGGCAGCCGGCGAGAATAACCCTGT
>probe:Drosophila_2:1631956_at:478:31; Interrogation_Position=1109; Antisense; ATAACCCTGTTGTCCGAAGAACTGG
>probe:Drosophila_2:1631956_at:611:209; Interrogation_Position=1135; Antisense; AAGCAGCCACGCGACGATGACGAAT
>probe:Drosophila_2:1631956_at:384:35; Interrogation_Position=1210; Antisense; ATCAGCTGCCAGGAAGTTTACCTAA
>probe:Drosophila_2:1631956_at:460:411; Interrogation_Position=1297; Antisense; GACCCGTCGCCATTCAAGGATGAAA
>probe:Drosophila_2:1631956_at:208:547; Interrogation_Position=1314; Antisense; GGATGAAACCACTCAGACGCTATAT
>probe:Drosophila_2:1631956_at:455:21; Interrogation_Position=1335; Antisense; ATATAGGGAATCCTCGGCGCAGACC
>probe:Drosophila_2:1631956_at:403:351; Interrogation_Position=1353; Antisense; GCAGACCTTGGCCTATTTGCCAGAA
>probe:Drosophila_2:1631956_at:359:55; Interrogation_Position=1391; Antisense; ATGAAGCCCGTACCCTAGAACTGTT
>probe:Drosophila_2:1631956_at:699:675; Interrogation_Position=1406; Antisense; TAGAACTGTTCATACTGCCCTCGGT
>probe:Drosophila_2:1631956_at:466:659; Interrogation_Position=1443; Antisense; TAAGCCTCCGGGTCTGTACGAAGTG
>probe:Drosophila_2:1631956_at:622:523; Interrogation_Position=1481; Antisense; GGGCTCGTAGGCGTCATAAATTCTT
>probe:Drosophila_2:1631956_at:283:235; Interrogation_Position=962; Antisense; AATGCCAGCCTGTTGAAGTCCCAAA

Paste this into a BLAST search page for me
GCAACTTCTTTACAGGATCAGCGATTGGCAGCCGGCGAGAATAACCCTGTATAACCCTGTTGTCCGAAGAACTGGAAGCAGCCACGCGACGATGACGAATATCAGCTGCCAGGAAGTTTACCTAAGACCCGTCGCCATTCAAGGATGAAAGGATGAAACCACTCAGACGCTATATATATAGGGAATCCTCGGCGCAGACCGCAGACCTTGGCCTATTTGCCAGAAATGAAGCCCGTACCCTAGAACTGTTTAGAACTGTTCATACTGCCCTCGGTTAAGCCTCCGGGTCTGTACGAAGTGGGGCTCGTAGGCGTCATAAATTCTTAATGCCAGCCTGTTGAAGTCCCAAA

Full Affymetrix probeset data:

Annotations for 1631956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720