FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631962_at:

>probe:Drosophila_2:1631962_at:280:87; Interrogation_Position=101; Antisense; AGTGCCAGTGCTCCTGCTAGAACGG
>probe:Drosophila_2:1631962_at:403:85; Interrogation_Position=107; Antisense; AGTGCTCCTGCTAGAACGGACCCAA
>probe:Drosophila_2:1631962_at:557:675; Interrogation_Position=118; Antisense; TAGAACGGACCCAAGGACAAGTGCT
>probe:Drosophila_2:1631962_at:30:75; Interrogation_Position=131; Antisense; AGGACAAGTGCTGCTCCACCAAAAA
>probe:Drosophila_2:1631962_at:645:507; Interrogation_Position=138; Antisense; GTGCTGCTCCACCAAAAACTAGATA
>probe:Drosophila_2:1631962_at:219:193; Interrogation_Position=154; Antisense; AACTAGATACAGGACCCATCTCGAG
>probe:Drosophila_2:1631962_at:151:457; Interrogation_Position=159; Antisense; GATACAGGACCCATCTCGAGCTCAT
>probe:Drosophila_2:1631962_at:439:133; Interrogation_Position=167; Antisense; ACCCATCTCGAGCTCATCTGTGTGA
>probe:Drosophila_2:1631962_at:369:185; Interrogation_Position=17; Antisense; AACACAAAATGGGTTGCAAGGCTTG
>probe:Drosophila_2:1631962_at:159:41; Interrogation_Position=182; Antisense; ATCTGTGTGATGAAAGACCCTTTGG
>probe:Drosophila_2:1631962_at:211:393; Interrogation_Position=193; Antisense; GAAAGACCCTTTGGCATGACAACGA
>probe:Drosophila_2:1631962_at:513:411; Interrogation_Position=197; Antisense; GACCCTTTGGCATGACAACGAAATA
>probe:Drosophila_2:1631962_at:648:227; Interrogation_Position=24; Antisense; AATGGGTTGCAAGGCTTGTGGAACA
>probe:Drosophila_2:1631962_at:617:631; Interrogation_Position=61; Antisense; TCCGCCACCAAGTGCGGTGACAACT

Paste this into a BLAST search page for me
AGTGCCAGTGCTCCTGCTAGAACGGAGTGCTCCTGCTAGAACGGACCCAATAGAACGGACCCAAGGACAAGTGCTAGGACAAGTGCTGCTCCACCAAAAAGTGCTGCTCCACCAAAAACTAGATAAACTAGATACAGGACCCATCTCGAGGATACAGGACCCATCTCGAGCTCATACCCATCTCGAGCTCATCTGTGTGAAACACAAAATGGGTTGCAAGGCTTGATCTGTGTGATGAAAGACCCTTTGGGAAAGACCCTTTGGCATGACAACGAGACCCTTTGGCATGACAACGAAATAAATGGGTTGCAAGGCTTGTGGAACATCCGCCACCAAGTGCGGTGACAACT

Full Affymetrix probeset data:

Annotations for 1631962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720