FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631964_at:

>probe:Drosophila_2:1631964_at:561:331; Interrogation_Position=1025; Antisense; GCGGCAAGGCATTCTATAGCTTTCA
>probe:Drosophila_2:1631964_at:73:677; Interrogation_Position=1041; Antisense; TAGCTTTCATGACCTCAATGTCCAT
>probe:Drosophila_2:1631964_at:664:61; Interrogation_Position=1058; Antisense; ATGTCCATGCTGTATCGCATACCAA
>probe:Drosophila_2:1631964_at:371:331; Interrogation_Position=1109; Antisense; GCGGCTCCACGTTTCAACGGAAGAA
>probe:Drosophila_2:1631964_at:30:353; Interrogation_Position=1167; Antisense; GCAGCGCAAGTACGCGTGCAAATTG
>probe:Drosophila_2:1631964_at:308:81; Interrogation_Position=1211; Antisense; AGTCCGGCGGTCTAAATGCCCACAT
>probe:Drosophila_2:1631964_at:700:297; Interrogation_Position=1237; Antisense; CGCAGCCATGATCCGGCGAGAGTTA
>probe:Drosophila_2:1631964_at:105:711; Interrogation_Position=1259; Antisense; TTAAGGGAGCTGTGAAGCCGCTGCC
>probe:Drosophila_2:1631964_at:305:269; Interrogation_Position=1341; Antisense; CATGGCCATCGACCTCAATGTGGAG
>probe:Drosophila_2:1631964_at:344:563; Interrogation_Position=852; Antisense; GGAATGCGACGCGACCTTTTACACG
>probe:Drosophila_2:1631964_at:161:185; Interrogation_Position=878; Antisense; AAAAGGAGCTCTCCTCGCACAGTAT
>probe:Drosophila_2:1631964_at:174:89; Interrogation_Position=898; Antisense; AGTATCTGCCATACTGGTCGCATGC
>probe:Drosophila_2:1631964_at:326:623; Interrogation_Position=940; Antisense; TGCGGACGACCTTGCCGAGATCGAG
>probe:Drosophila_2:1631964_at:393:97; Interrogation_Position=957; Antisense; AGATCGAGGCGTTCTCACGGCGCAT

Paste this into a BLAST search page for me
GCGGCAAGGCATTCTATAGCTTTCATAGCTTTCATGACCTCAATGTCCATATGTCCATGCTGTATCGCATACCAAGCGGCTCCACGTTTCAACGGAAGAAGCAGCGCAAGTACGCGTGCAAATTGAGTCCGGCGGTCTAAATGCCCACATCGCAGCCATGATCCGGCGAGAGTTATTAAGGGAGCTGTGAAGCCGCTGCCCATGGCCATCGACCTCAATGTGGAGGGAATGCGACGCGACCTTTTACACGAAAAGGAGCTCTCCTCGCACAGTATAGTATCTGCCATACTGGTCGCATGCTGCGGACGACCTTGCCGAGATCGAGAGATCGAGGCGTTCTCACGGCGCAT

Full Affymetrix probeset data:

Annotations for 1631964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720