FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631965_at:

>probe:Drosophila_2:1631965_at:9:577; Interrogation_Position=1032; Antisense; GGCGCTCGACCGGATGAGGCTATAT
>probe:Drosophila_2:1631965_at:90:547; Interrogation_Position=1076; Antisense; GGATGCCACCCCTGTTAAGGTGTAT
>probe:Drosophila_2:1631965_at:280:67; Interrogation_Position=1105; Antisense; AGGCTAGCTTGGTCTTTCCGTTGAT
>probe:Drosophila_2:1631965_at:365:101; Interrogation_Position=1172; Antisense; AGAGCTGCCCCGAGAGACTAACCAA
>probe:Drosophila_2:1631965_at:287:217; Interrogation_Position=1195; Antisense; AAGTATGCAAACTGTCCGGGCAGGA
>probe:Drosophila_2:1631965_at:328:561; Interrogation_Position=1217; Antisense; GGAAGCCATTAAGCGTCGTCGGAGT
>probe:Drosophila_2:1631965_at:183:469; Interrogation_Position=733; Antisense; GTTCCATTTACTATTGGGCTGCCAA
>probe:Drosophila_2:1631965_at:630:31; Interrogation_Position=760; Antisense; ATCAAATACCAGTCTTTTGTCCCGC
>probe:Drosophila_2:1631965_at:492:575; Interrogation_Position=804; Antisense; GGCGACATGATGTACTTTCACTCCT
>probe:Drosophila_2:1631965_at:222:397; Interrogation_Position=832; Antisense; GACAACCTGGACTCGTGGTGGACAT
>probe:Drosophila_2:1631965_at:24:439; Interrogation_Position=872; Antisense; GAGGCTCAACACCATGGCTGTCAAG
>probe:Drosophila_2:1631965_at:428:573; Interrogation_Position=927; Antisense; GGCGGCGTTATCAAGCATCACATTT
>probe:Drosophila_2:1631965_at:124:553; Interrogation_Position=975; Antisense; GGAGCGGATTACTCAGTGTTCATTA
>probe:Drosophila_2:1631965_at:606:513; Interrogation_Position=990; Antisense; GTGTTCATTAATACTGCCTCGGAGT

Paste this into a BLAST search page for me
GGCGCTCGACCGGATGAGGCTATATGGATGCCACCCCTGTTAAGGTGTATAGGCTAGCTTGGTCTTTCCGTTGATAGAGCTGCCCCGAGAGACTAACCAAAAGTATGCAAACTGTCCGGGCAGGAGGAAGCCATTAAGCGTCGTCGGAGTGTTCCATTTACTATTGGGCTGCCAAATCAAATACCAGTCTTTTGTCCCGCGGCGACATGATGTACTTTCACTCCTGACAACCTGGACTCGTGGTGGACATGAGGCTCAACACCATGGCTGTCAAGGGCGGCGTTATCAAGCATCACATTTGGAGCGGATTACTCAGTGTTCATTAGTGTTCATTAATACTGCCTCGGAGT

Full Affymetrix probeset data:

Annotations for 1631965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720