FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631969_at:

>probe:Drosophila_2:1631969_at:666:349; Interrogation_Position=1016; Antisense; GCACTGTCCTGCAGGGTTTTAATAT
>probe:Drosophila_2:1631969_at:638:79; Interrogation_Position=1103; Antisense; AGGTGATGATCATTATCGCCGCCTG
>probe:Drosophila_2:1631969_at:267:619; Interrogation_Position=1126; Antisense; TGCTTCGTGGTGATCTACCTGATCT
>probe:Drosophila_2:1631969_at:600:37; Interrogation_Position=1147; Antisense; ATCTTTGCCTACATCATCGACTATA
>probe:Drosophila_2:1631969_at:158:367; Interrogation_Position=1182; Antisense; GAATCTGCTGATGGCCTGGATGGTT
>probe:Drosophila_2:1631969_at:268:641; Interrogation_Position=1217; Antisense; TCTGTTTGGTGGCACTGCACTATGT
>probe:Drosophila_2:1631969_at:345:413; Interrogation_Position=1272; Antisense; GACCGTTGTGATGGCCATTGGCAAT
>probe:Drosophila_2:1631969_at:340:247; Interrogation_Position=1294; Antisense; AATTGCGGCGGCCTGGTTAGCACCA
>probe:Drosophila_2:1631969_at:364:565; Interrogation_Position=1326; Antisense; GGAATTCTATCCGACGCATATCAAT
>probe:Drosophila_2:1631969_at:255:235; Interrogation_Position=1348; Antisense; AATGCCATGGGCATGTGCTTCATCA
>probe:Drosophila_2:1631969_at:3:525; Interrogation_Position=1401; Antisense; GGGCAGCAATATCCTTGGTCGCCTG
>probe:Drosophila_2:1631969_at:556:729; Interrogation_Position=1462; Antisense; TTGGCCCTGGTGGTGTTGCTCTGCA
>probe:Drosophila_2:1631969_at:267:377; Interrogation_Position=1527; Antisense; GAAGAAGCCATCTGCCACAGCAAAG
>probe:Drosophila_2:1631969_at:349:127; Interrogation_Position=1567; Antisense; ACCACTAGTCCCATTTTTGCTATTA

Paste this into a BLAST search page for me
GCACTGTCCTGCAGGGTTTTAATATAGGTGATGATCATTATCGCCGCCTGTGCTTCGTGGTGATCTACCTGATCTATCTTTGCCTACATCATCGACTATAGAATCTGCTGATGGCCTGGATGGTTTCTGTTTGGTGGCACTGCACTATGTGACCGTTGTGATGGCCATTGGCAATAATTGCGGCGGCCTGGTTAGCACCAGGAATTCTATCCGACGCATATCAATAATGCCATGGGCATGTGCTTCATCAGGGCAGCAATATCCTTGGTCGCCTGTTGGCCCTGGTGGTGTTGCTCTGCAGAAGAAGCCATCTGCCACAGCAAAGACCACTAGTCCCATTTTTGCTATTA

Full Affymetrix probeset data:

Annotations for 1631969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720