Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631971_at:

>probe:Drosophila_2:1631971_at:561:449; Interrogation_Position=1036; Antisense; GATCCGTGAGGAAATCGCTTCTCTG
>probe:Drosophila_2:1631971_at:141:429; Interrogation_Position=1181; Antisense; GAGTCTAAGGAGAAGTACACCGCCA
>probe:Drosophila_2:1631971_at:17:491; Interrogation_Position=1195; Antisense; GTACACCGCCAAAGTAAAGCTTCAA
>probe:Drosophila_2:1631971_at:211:341; Interrogation_Position=1213; Antisense; GCTTCAACCGAAGGGACAGTCAAGA
>probe:Drosophila_2:1631971_at:226:399; Interrogation_Position=1227; Antisense; GACAGTCAAGAGAGGCATTTACATT
>probe:Drosophila_2:1631971_at:408:709; Interrogation_Position=1245; Antisense; TTACATTGAGCCTACTCTCCAAGTT
>probe:Drosophila_2:1631971_at:158:89; Interrogation_Position=1299; Antisense; AGTCAAGCTCTGATGATGGCGAATC
>probe:Drosophila_2:1631971_at:117:105; Interrogation_Position=1339; Antisense; AGACGATCGCGTAGTAGAACAGGAA
>probe:Drosophila_2:1631971_at:482:407; Interrogation_Position=1373; Antisense; GACGATTGGTTGTCGCATACCTTAA
>probe:Drosophila_2:1631971_at:417:649; Interrogation_Position=1402; Antisense; TAATAGTACGACTCCGGTTTTAGCT
>probe:Drosophila_2:1631971_at:58:305; Interrogation_Position=1415; Antisense; CCGGTTTTAGCTAAGGATGCCAATA
>probe:Drosophila_2:1631971_at:211:465; Interrogation_Position=1451; Antisense; GATTGGTACGATGCCTACGATCCAC
>probe:Drosophila_2:1631971_at:250:279; Interrogation_Position=1465; Antisense; CTACGATCCACGAAATCCTCTAAAT
>probe:Drosophila_2:1631971_at:319:575; Interrogation_Position=1502; Antisense; GGCGAAACTGGCTCTAGTAAATCGA

Paste this into a BLAST search page for me
GATCCGTGAGGAAATCGCTTCTCTGGAGTCTAAGGAGAAGTACACCGCCAGTACACCGCCAAAGTAAAGCTTCAAGCTTCAACCGAAGGGACAGTCAAGAGACAGTCAAGAGAGGCATTTACATTTTACATTGAGCCTACTCTCCAAGTTAGTCAAGCTCTGATGATGGCGAATCAGACGATCGCGTAGTAGAACAGGAAGACGATTGGTTGTCGCATACCTTAATAATAGTACGACTCCGGTTTTAGCTCCGGTTTTAGCTAAGGATGCCAATAGATTGGTACGATGCCTACGATCCACCTACGATCCACGAAATCCTCTAAATGGCGAAACTGGCTCTAGTAAATCGA

Full Affymetrix probeset data:

Annotations for 1631971_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime