FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631975_at:

>probe:Drosophila_2:1631975_at:19:415; Interrogation_Position=103; Antisense; GACCACTGTGAGGCGGTGGCAACAA
>probe:Drosophila_2:1631975_at:211:283; Interrogation_Position=135; Antisense; CTGCGGCGAAAGCAGCAACATCTGC
>probe:Drosophila_2:1631975_at:167:415; Interrogation_Position=15; Antisense; GAGCGAATTACAAGGGCGACTCCCC
>probe:Drosophila_2:1631975_at:622:723; Interrogation_Position=189; Antisense; TTGCTGCGGCGCTTTCATGGCTGCT
>probe:Drosophila_2:1631975_at:346:341; Interrogation_Position=199; Antisense; GCTTTCATGGCTGCTGCTCCTTGGT
>probe:Drosophila_2:1631975_at:576:621; Interrogation_Position=210; Antisense; TGCTGCTCCTTGGTCCGCGAAATCA
>probe:Drosophila_2:1631975_at:21:275; Interrogation_Position=218; Antisense; CTTGGTCCGCGAAATCAGTTCGTTG
>probe:Drosophila_2:1631975_at:482:297; Interrogation_Position=224; Antisense; CCGCGAAATCAGTTCGTTGTCGTCA
>probe:Drosophila_2:1631975_at:242:323; Interrogation_Position=30; Antisense; GCGACTCCCCTAAGCTAAAACTGAA
>probe:Drosophila_2:1631975_at:567:387; Interrogation_Position=52; Antisense; GAAAATTTTCTTCGAGACCTGTCTA
>probe:Drosophila_2:1631975_at:480:425; Interrogation_Position=65; Antisense; GAGACCTGTCTAGAACGTTTATGGA
>probe:Drosophila_2:1631975_at:605:381; Interrogation_Position=77; Antisense; GAACGTTTATGGAATCATCGACATC
>probe:Drosophila_2:1631975_at:39:565; Interrogation_Position=87; Antisense; GGAATCATCGACATCGGACCACTGT
>probe:Drosophila_2:1631975_at:4:45; Interrogation_Position=93; Antisense; ATCGACATCGGACCACTGTGAGGCG

Paste this into a BLAST search page for me
GACCACTGTGAGGCGGTGGCAACAACTGCGGCGAAAGCAGCAACATCTGCGAGCGAATTACAAGGGCGACTCCCCTTGCTGCGGCGCTTTCATGGCTGCTGCTTTCATGGCTGCTGCTCCTTGGTTGCTGCTCCTTGGTCCGCGAAATCACTTGGTCCGCGAAATCAGTTCGTTGCCGCGAAATCAGTTCGTTGTCGTCAGCGACTCCCCTAAGCTAAAACTGAAGAAAATTTTCTTCGAGACCTGTCTAGAGACCTGTCTAGAACGTTTATGGAGAACGTTTATGGAATCATCGACATCGGAATCATCGACATCGGACCACTGTATCGACATCGGACCACTGTGAGGCG

Full Affymetrix probeset data:

Annotations for 1631975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720