FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631977_at:

>probe:Drosophila_2:1631977_at:263:193; Interrogation_Position=1142; Antisense; AACTCTACCACAAGTGAGGTCCGGA
>probe:Drosophila_2:1631977_at:357:543; Interrogation_Position=1164; Antisense; GGATAAGTCGCAACACCTGGCTATG
>probe:Drosophila_2:1631977_at:520:137; Interrogation_Position=1191; Antisense; ACGATGCGAATCCATGGCTTTCCAA
>probe:Drosophila_2:1631977_at:212:123; Interrogation_Position=1224; Antisense; AGCGATTGGAGGATGTCACCGGACT
>probe:Drosophila_2:1631977_at:262:527; Interrogation_Position=1297; Antisense; GGGACAGTATGAGCCGCACTTTGAC
>probe:Drosophila_2:1631977_at:175:125; Interrogation_Position=1308; Antisense; AGCCGCACTTTGACTTCGTGGAGGA
>probe:Drosophila_2:1631977_at:470:119; Interrogation_Position=1352; Antisense; AGCTGGAAGGGCAACCGCCTGTTGA
>probe:Drosophila_2:1631977_at:68:155; Interrogation_Position=1376; Antisense; ACAGCTCTTTTCTACCTAAATGATG
>probe:Drosophila_2:1631977_at:513:563; Interrogation_Position=1460; Antisense; GGAAGTCTTTTAATCTGGTACAATC
>probe:Drosophila_2:1631977_at:22:403; Interrogation_Position=1505; Antisense; GACTTTCGCACGAAGCATGCTGGTT
>probe:Drosophila_2:1631977_at:722:721; Interrogation_Position=1528; Antisense; TTGCCCCGTTCTTCAAGGATCAAAG
>probe:Drosophila_2:1631977_at:20:55; Interrogation_Position=1563; Antisense; ATGAGTGGTTCCATGTGGGTGCCCA
>probe:Drosophila_2:1631977_at:84:507; Interrogation_Position=1581; Antisense; GTGCCCAGGAATTCAGGCGACCTTG
>probe:Drosophila_2:1631977_at:640:267; Interrogation_Position=1594; Antisense; CAGGCGACCTTGTGGCTTGAGCAGT

Paste this into a BLAST search page for me
AACTCTACCACAAGTGAGGTCCGGAGGATAAGTCGCAACACCTGGCTATGACGATGCGAATCCATGGCTTTCCAAAGCGATTGGAGGATGTCACCGGACTGGGACAGTATGAGCCGCACTTTGACAGCCGCACTTTGACTTCGTGGAGGAAGCTGGAAGGGCAACCGCCTGTTGAACAGCTCTTTTCTACCTAAATGATGGGAAGTCTTTTAATCTGGTACAATCGACTTTCGCACGAAGCATGCTGGTTTTGCCCCGTTCTTCAAGGATCAAAGATGAGTGGTTCCATGTGGGTGCCCAGTGCCCAGGAATTCAGGCGACCTTGCAGGCGACCTTGTGGCTTGAGCAGT

Full Affymetrix probeset data:

Annotations for 1631977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720