Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631979_at:

>probe:Drosophila_2:1631979_at:320:329; Interrogation_Position=2751; Antisense; GCGGAACTGATGTACCTTCGACGTC
>probe:Drosophila_2:1631979_at:215:717; Interrogation_Position=2767; Antisense; TTCGACGTCAGCATCGCCTGGAGCA
>probe:Drosophila_2:1631979_at:25:553; Interrogation_Position=2840; Antisense; GGAGCACAACAAAACCGATTCGGAT
>probe:Drosophila_2:1631979_at:488:201; Interrogation_Position=2852; Antisense; AACCGATTCGGATAAAGCCCATGAG
>probe:Drosophila_2:1631979_at:564:373; Interrogation_Position=2877; Antisense; GAAGTATTAATCAATCGCCTTGTGA
>probe:Drosophila_2:1631979_at:729:315; Interrogation_Position=2935; Antisense; GCCTAGAGACTGACCGAGTTCGCGA
>probe:Drosophila_2:1631979_at:607:419; Interrogation_Position=2975; Antisense; GAGCATCAAGAATCGGCTTCATATA
>probe:Drosophila_2:1631979_at:173:247; Interrogation_Position=3003; Antisense; AATTCTGAGCGCGAGGAACCACCAG
>probe:Drosophila_2:1631979_at:17:73; Interrogation_Position=3016; Antisense; AGGAACCACCAGCACATCCGAGAAG
>probe:Drosophila_2:1631979_at:394:423; Interrogation_Position=3035; Antisense; GAGAAGCGCTGACAAATCATCCAAA
>probe:Drosophila_2:1631979_at:168:357; Interrogation_Position=3109; Antisense; GCAAGGGCAAAAAGTCGGACCTCGA
>probe:Drosophila_2:1631979_at:621:443; Interrogation_Position=3144; Antisense; GATGAGTCCGAACAGGCACCAGCTT
>probe:Drosophila_2:1631979_at:222:603; Interrogation_Position=3228; Antisense; TGAGTTGAAGTGTTTACGCATCGAA
>probe:Drosophila_2:1631979_at:131:657; Interrogation_Position=3289; Antisense; TAAGTTTCTATTGCCATATGTGAGC

Paste this into a BLAST search page for me
GCGGAACTGATGTACCTTCGACGTCTTCGACGTCAGCATCGCCTGGAGCAGGAGCACAACAAAACCGATTCGGATAACCGATTCGGATAAAGCCCATGAGGAAGTATTAATCAATCGCCTTGTGAGCCTAGAGACTGACCGAGTTCGCGAGAGCATCAAGAATCGGCTTCATATAAATTCTGAGCGCGAGGAACCACCAGAGGAACCACCAGCACATCCGAGAAGGAGAAGCGCTGACAAATCATCCAAAGCAAGGGCAAAAAGTCGGACCTCGAGATGAGTCCGAACAGGCACCAGCTTTGAGTTGAAGTGTTTACGCATCGAATAAGTTTCTATTGCCATATGTGAGC

Full Affymetrix probeset data:

Annotations for 1631979_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime