FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631981_at:

>probe:Drosophila_2:1631981_at:120:167; Interrogation_Position=1011; Antisense; AAATGGACGGGCTCAAGTCGTACTT
>probe:Drosophila_2:1631981_at:683:87; Interrogation_Position=1026; Antisense; AGTCGTACTTCTCCAATCTGTTTAA
>probe:Drosophila_2:1631981_at:701:547; Interrogation_Position=1066; Antisense; GGAGGACAGCACCAACAAGTTCTTC
>probe:Drosophila_2:1631981_at:628:471; Interrogation_Position=1084; Antisense; GTTCTTCAACGACAACTGGCGGATG
>probe:Drosophila_2:1631981_at:439:687; Interrogation_Position=1179; Antisense; TATTTCACTTCATTCCAGCCAACTT
>probe:Drosophila_2:1631981_at:540:191; Interrogation_Position=1199; Antisense; AACTTCTTTGTGAGCGACATCCCGA
>probe:Drosophila_2:1631981_at:707:301; Interrogation_Position=1220; Antisense; CCGACGCCGGAACAGCTTTATGGAA
>probe:Drosophila_2:1631981_at:650:9; Interrogation_Position=750; Antisense; ATTCTAACCGAACCGCAGCAGATTA
>probe:Drosophila_2:1631981_at:676:257; Interrogation_Position=814; Antisense; CACCTTTACACTGCCCGAGATGAAG
>probe:Drosophila_2:1631981_at:571:443; Interrogation_Position=832; Antisense; GATGAAGCTCCAGGCGGACTACAGT
>probe:Drosophila_2:1631981_at:579:555; Interrogation_Position=847; Antisense; GGACTACAGTCTTTTCGGTCGGATC
>probe:Drosophila_2:1631981_at:372:55; Interrogation_Position=923; Antisense; ATGACGGTCACCATGCACACGAAGA
>probe:Drosophila_2:1631981_at:186:209; Interrogation_Position=944; Antisense; AAGACTCGGCTCTACTCCAAGGGTG
>probe:Drosophila_2:1631981_at:645:529; Interrogation_Position=964; Antisense; GGGTGGGTTCACTTTCTACAACGTG

Paste this into a BLAST search page for me
AAATGGACGGGCTCAAGTCGTACTTAGTCGTACTTCTCCAATCTGTTTAAGGAGGACAGCACCAACAAGTTCTTCGTTCTTCAACGACAACTGGCGGATGTATTTCACTTCATTCCAGCCAACTTAACTTCTTTGTGAGCGACATCCCGACCGACGCCGGAACAGCTTTATGGAAATTCTAACCGAACCGCAGCAGATTACACCTTTACACTGCCCGAGATGAAGGATGAAGCTCCAGGCGGACTACAGTGGACTACAGTCTTTTCGGTCGGATCATGACGGTCACCATGCACACGAAGAAAGACTCGGCTCTACTCCAAGGGTGGGGTGGGTTCACTTTCTACAACGTG

Full Affymetrix probeset data:

Annotations for 1631981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720