FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631984_at:

>probe:Drosophila_2:1631984_at:590:659; Interrogation_Position=338; Antisense; TAACCTTCATGCCTTACGTGGAGCG
>probe:Drosophila_2:1631984_at:615:657; Interrogation_Position=368; Antisense; TAAGGACCAGGATCACCAGGCACGA
>probe:Drosophila_2:1631984_at:354:529; Interrogation_Position=407; Antisense; GGGAGCAACGCCTTCTAAGCGCATT
>probe:Drosophila_2:1631984_at:485:297; Interrogation_Position=458; Antisense; CGCACACATTCTTTTACCTCGTAAA
>probe:Drosophila_2:1631984_at:175:413; Interrogation_Position=567; Antisense; GACCTACGTGGTCCTAAAGATGCTG
>probe:Drosophila_2:1631984_at:715:171; Interrogation_Position=582; Antisense; AAAGATGCTGGAGGTCTTGGCCTTC
>probe:Drosophila_2:1631984_at:307:631; Interrogation_Position=608; Antisense; TCCTGCAGTTCGTCCAGTGGTGGTA
>probe:Drosophila_2:1631984_at:616:83; Interrogation_Position=623; Antisense; AGTGGTGGTACTCCAACGACCAGCG
>probe:Drosophila_2:1631984_at:106:457; Interrogation_Position=669; Antisense; GATAAATCCCGAAGCGATGCCGAGA
>probe:Drosophila_2:1631984_at:567:447; Interrogation_Position=684; Antisense; GATGCCGAGAAAGCAGCTGCCCAAG
>probe:Drosophila_2:1631984_at:282:289; Interrogation_Position=792; Antisense; CGGCTACGTCTTTTGCTGGAAGTGC
>probe:Drosophila_2:1631984_at:465:373; Interrogation_Position=810; Antisense; GAAGTGCATCGTTAGCCACATGAAG
>probe:Drosophila_2:1631984_at:688:683; Interrogation_Position=862; Antisense; TATCCCATCAGTCTGGACGACCTGG
>probe:Drosophila_2:1631984_at:398:131; Interrogation_Position=881; Antisense; ACCTGGTGCGCATCTACGAGACGTA

Paste this into a BLAST search page for me
TAACCTTCATGCCTTACGTGGAGCGTAAGGACCAGGATCACCAGGCACGAGGGAGCAACGCCTTCTAAGCGCATTCGCACACATTCTTTTACCTCGTAAAGACCTACGTGGTCCTAAAGATGCTGAAAGATGCTGGAGGTCTTGGCCTTCTCCTGCAGTTCGTCCAGTGGTGGTAAGTGGTGGTACTCCAACGACCAGCGGATAAATCCCGAAGCGATGCCGAGAGATGCCGAGAAAGCAGCTGCCCAAGCGGCTACGTCTTTTGCTGGAAGTGCGAAGTGCATCGTTAGCCACATGAAGTATCCCATCAGTCTGGACGACCTGGACCTGGTGCGCATCTACGAGACGTA

Full Affymetrix probeset data:

Annotations for 1631984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720