FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631986_at:

>probe:Drosophila_2:1631986_at:594:729; Interrogation_Position=190; Antisense; TTGGTGACGGCTGGACATTGTGTTC
>probe:Drosophila_2:1631986_at:443:683; Interrogation_Position=217; Antisense; TATCCAGATAGCTACTCCGTTCGTG
>probe:Drosophila_2:1631986_at:659:471; Interrogation_Position=235; Antisense; GTTCGTGCAGGATCTACTTTCACTG
>probe:Drosophila_2:1631986_at:91:513; Interrogation_Position=286; Antisense; GTGAGTGTTATCCTTCATCCAGATT
>probe:Drosophila_2:1631986_at:652:157; Interrogation_Position=330; Antisense; AAACGACATCGCCTTGTTGAAGTTA
>probe:Drosophila_2:1631986_at:358:689; Interrogation_Position=381; Antisense; TATTCAGGTGGTGAAGCTGCCGCTT
>probe:Drosophila_2:1631986_at:614:625; Interrogation_Position=398; Antisense; TGCCGCTTCCGAGTCTTAATATACT
>probe:Drosophila_2:1631986_at:617:205; Interrogation_Position=476; Antisense; AATCGGAACCTAGACTACGTGGCAC
>probe:Drosophila_2:1631986_at:434:655; Interrogation_Position=516; Antisense; TAATCAGAGACTTTGCCAGCGACTT
>probe:Drosophila_2:1631986_at:213:587; Interrogation_Position=594; Antisense; TGGACGAGATCACTGCTACGGCGAC
>probe:Drosophila_2:1631986_at:197:473; Interrogation_Position=634; Antisense; GTTCACCGCGGCAGTAGCTATGGAA
>probe:Drosophila_2:1631986_at:457:585; Interrogation_Position=654; Antisense; TGGAATCGTATCCTTTGCGCATGGA
>probe:Drosophila_2:1631986_at:609:697; Interrogation_Position=693; Antisense; TTTTCCAGGCGTGTACACTAGGCTA
>probe:Drosophila_2:1631986_at:723:569; Interrogation_Position=713; Antisense; GGCTAGCCAACTATGTTACCTGGAT

Paste this into a BLAST search page for me
TTGGTGACGGCTGGACATTGTGTTCTATCCAGATAGCTACTCCGTTCGTGGTTCGTGCAGGATCTACTTTCACTGGTGAGTGTTATCCTTCATCCAGATTAAACGACATCGCCTTGTTGAAGTTATATTCAGGTGGTGAAGCTGCCGCTTTGCCGCTTCCGAGTCTTAATATACTAATCGGAACCTAGACTACGTGGCACTAATCAGAGACTTTGCCAGCGACTTTGGACGAGATCACTGCTACGGCGACGTTCACCGCGGCAGTAGCTATGGAATGGAATCGTATCCTTTGCGCATGGATTTTCCAGGCGTGTACACTAGGCTAGGCTAGCCAACTATGTTACCTGGAT

Full Affymetrix probeset data:

Annotations for 1631986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720