FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631988_at:

>probe:Drosophila_2:1631988_at:281:571; Interrogation_Position=1215; Antisense; GGCTTGTCTCAAGCGTTACGAGTTC
>probe:Drosophila_2:1631988_at:720:613; Interrogation_Position=1247; Antisense; TGAACGTCATCACCAGTCGCGAGAA
>probe:Drosophila_2:1631988_at:521:95; Interrogation_Position=1394; Antisense; AGATCAAGGGTCCTGCGCGAAGCAA
>probe:Drosophila_2:1631988_at:487:287; Interrogation_Position=1422; Antisense; CGGACCGCGTGCCAATAACAGTTAC
>probe:Drosophila_2:1631988_at:585:153; Interrogation_Position=1439; Antisense; ACAGTTACGGCCCAGCATCGAGTTC
>probe:Drosophila_2:1631988_at:61:39; Interrogation_Position=1455; Antisense; ATCGAGTTCCGGATCCGCAAAGGGC
>probe:Drosophila_2:1631988_at:630:517; Interrogation_Position=1516; Antisense; GTGGTGCGTATTTATTTTGCCGAAA
>probe:Drosophila_2:1631988_at:465:175; Interrogation_Position=1538; Antisense; AAACGCACATTCAATACTTTCGCCA
>probe:Drosophila_2:1631988_at:566:11; Interrogation_Position=1567; Antisense; ATTAAGAGCGCCTGGTACGAGACCT
>probe:Drosophila_2:1631988_at:604:137; Interrogation_Position=1583; Antisense; ACGAGACCTTCAGTACAATTGGCAA
>probe:Drosophila_2:1631988_at:391:249; Interrogation_Position=1598; Antisense; CAATTGGCAACATCTGCGGCATTAT
>probe:Drosophila_2:1631988_at:434:345; Interrogation_Position=1616; Antisense; GCATTATAGCCGGTTTCTCGCTGAT
>probe:Drosophila_2:1631988_at:117:327; Interrogation_Position=1649; Antisense; GCGAGCTGTTGTTTTTTCTAGCCAA
>probe:Drosophila_2:1631988_at:577:245; Interrogation_Position=1676; Antisense; AATTATGGCAGGCATGCCGCGCAGA

Paste this into a BLAST search page for me
GGCTTGTCTCAAGCGTTACGAGTTCTGAACGTCATCACCAGTCGCGAGAAAGATCAAGGGTCCTGCGCGAAGCAACGGACCGCGTGCCAATAACAGTTACACAGTTACGGCCCAGCATCGAGTTCATCGAGTTCCGGATCCGCAAAGGGCGTGGTGCGTATTTATTTTGCCGAAAAAACGCACATTCAATACTTTCGCCAATTAAGAGCGCCTGGTACGAGACCTACGAGACCTTCAGTACAATTGGCAACAATTGGCAACATCTGCGGCATTATGCATTATAGCCGGTTTCTCGCTGATGCGAGCTGTTGTTTTTTCTAGCCAAAATTATGGCAGGCATGCCGCGCAGA

Full Affymetrix probeset data:

Annotations for 1631988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720