FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631990_at:

>probe:Drosophila_2:1631990_at:717:47; Interrogation_Position=1012; Antisense; ATCCTACTGATCTTCATGCAACTCA
>probe:Drosophila_2:1631990_at:629:343; Interrogation_Position=1076; Antisense; GCATCGGAATGAACGCCTTCTTTGC
>probe:Drosophila_2:1631990_at:406:231; Interrogation_Position=583; Antisense; AATGATTCCTATCCACCGATGACAT
>probe:Drosophila_2:1631990_at:407:611; Interrogation_Position=602; Antisense; TGACATTTTGCGTGGTTGCCGGTCA
>probe:Drosophila_2:1631990_at:350:59; Interrogation_Position=626; Antisense; ATGTAAGACTTTTGGCGATGCGCTT
>probe:Drosophila_2:1631990_at:396:565; Interrogation_Position=747; Antisense; GGAATTACTGCGCAGCACCATGAAT
>probe:Drosophila_2:1631990_at:103:129; Interrogation_Position=763; Antisense; ACCATGAATATTTCGCAGCTCGGCC
>probe:Drosophila_2:1631990_at:393:351; Interrogation_Position=777; Antisense; GCAGCTCGGCCAGTTTATTTCAAGT
>probe:Drosophila_2:1631990_at:332:679; Interrogation_Position=824; Antisense; TAGTCAACATTCTCTTCTTTGCGGA
>probe:Drosophila_2:1631990_at:135:715; Interrogation_Position=856; Antisense; TTCGCTATAACCTACTACGGAGTGT
>probe:Drosophila_2:1631990_at:599:433; Interrogation_Position=875; Antisense; GAGTGTACTTCCTATCGATGGTGTT
>probe:Drosophila_2:1631990_at:355:565; Interrogation_Position=900; Antisense; GGAATTATTCCCGTGCTGCTATTAC
>probe:Drosophila_2:1631990_at:589:567; Interrogation_Position=925; Antisense; GGCACCCTGATATCCGTGGAGATGA
>probe:Drosophila_2:1631990_at:315:445; Interrogation_Position=945; Antisense; GATGAACCAGCTGACCTATGCGATT

Paste this into a BLAST search page for me
ATCCTACTGATCTTCATGCAACTCAGCATCGGAATGAACGCCTTCTTTGCAATGATTCCTATCCACCGATGACATTGACATTTTGCGTGGTTGCCGGTCAATGTAAGACTTTTGGCGATGCGCTTGGAATTACTGCGCAGCACCATGAATACCATGAATATTTCGCAGCTCGGCCGCAGCTCGGCCAGTTTATTTCAAGTTAGTCAACATTCTCTTCTTTGCGGATTCGCTATAACCTACTACGGAGTGTGAGTGTACTTCCTATCGATGGTGTTGGAATTATTCCCGTGCTGCTATTACGGCACCCTGATATCCGTGGAGATGAGATGAACCAGCTGACCTATGCGATT

Full Affymetrix probeset data:

Annotations for 1631990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720