FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631991_at:

>probe:Drosophila_2:1631991_at:133:251; Interrogation_Position=1092; Antisense; CAAGGGATTACCAACGACGCGGCTA
>probe:Drosophila_2:1631991_at:152:47; Interrogation_Position=1126; Antisense; ATCCCCACCTGTGTATGCACTGAAA
>probe:Drosophila_2:1631991_at:686:511; Interrogation_Position=1163; Antisense; GTGATGATACCAAAGCGGCGACCAT
>probe:Drosophila_2:1631991_at:400:331; Interrogation_Position=1177; Antisense; GCGGCGACCATCTGGCATCGATAAG
>probe:Drosophila_2:1631991_at:286:389; Interrogation_Position=1222; Antisense; GAAACAGGTGGCTCTATGGCAACAG
>probe:Drosophila_2:1631991_at:446:67; Interrogation_Position=1237; Antisense; ATGGCAACAGGACTTCGACGCGATC
>probe:Drosophila_2:1631991_at:410:73; Interrogation_Position=1263; Antisense; AGGACAACGGGCAACCACTTCAGAT
>probe:Drosophila_2:1631991_at:18:371; Interrogation_Position=1371; Antisense; GAATGGTCGTCAAGAGCCGTGCTCC
>probe:Drosophila_2:1631991_at:423:481; Interrogation_Position=1418; Antisense; GTATTCAATTACTCCGGCCAGATGG
>probe:Drosophila_2:1631991_at:489:315; Interrogation_Position=1472; Antisense; GCCTACATGGGATCTCATCGCAAAT
>probe:Drosophila_2:1631991_at:661:641; Interrogation_Position=1496; Antisense; TCTAATGGCGAATCCTGGCGCAACT
>probe:Drosophila_2:1631991_at:9:275; Interrogation_Position=1519; Antisense; CTTCTTAAGGGCCAGCAGCTCATAA
>probe:Drosophila_2:1631991_at:270:509; Interrogation_Position=1569; Antisense; GTGAATTGCCTTTTTATCCAGAGTT
>probe:Drosophila_2:1631991_at:564:365; Interrogation_Position=1607; Antisense; GAATACTTGCTGAGCTCCTGGCAGA

Paste this into a BLAST search page for me
CAAGGGATTACCAACGACGCGGCTAATCCCCACCTGTGTATGCACTGAAAGTGATGATACCAAAGCGGCGACCATGCGGCGACCATCTGGCATCGATAAGGAAACAGGTGGCTCTATGGCAACAGATGGCAACAGGACTTCGACGCGATCAGGACAACGGGCAACCACTTCAGATGAATGGTCGTCAAGAGCCGTGCTCCGTATTCAATTACTCCGGCCAGATGGGCCTACATGGGATCTCATCGCAAATTCTAATGGCGAATCCTGGCGCAACTCTTCTTAAGGGCCAGCAGCTCATAAGTGAATTGCCTTTTTATCCAGAGTTGAATACTTGCTGAGCTCCTGGCAGA

Full Affymetrix probeset data:

Annotations for 1631991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720