FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631996_at:

>probe:Drosophila_2:1631996_at:726:103; Interrogation_Position=121; Antisense; AGACTTTCGCGGCAACACGCTGTGG
>probe:Drosophila_2:1631996_at:694:593; Interrogation_Position=141; Antisense; TGTGGGAGCTGGTCTCAAACCTGCC
>probe:Drosophila_2:1631996_at:656:579; Interrogation_Position=175; Antisense; TGTGGGCCGTCTGCTAATACGTAAC
>probe:Drosophila_2:1631996_at:122:139; Interrogation_Position=193; Antisense; ACGTAACATGTTCCAGCGATATCCG
>probe:Drosophila_2:1631996_at:369:125; Interrogation_Position=219; Antisense; AGCCCTGCTACATGCGGATTCTGAA
>probe:Drosophila_2:1631996_at:30:329; Interrogation_Position=315; Antisense; GCGTAACGCAGCCAAAGCCTGTGGA
>probe:Drosophila_2:1631996_at:25:355; Interrogation_Position=348; Antisense; GCACCAGCTATAAGGCGGACTACGA
>probe:Drosophila_2:1631996_at:549:557; Interrogation_Position=364; Antisense; GGACTACGAACTGGTGCCGCAGGAT
>probe:Drosophila_2:1631996_at:401:77; Interrogation_Position=420; Antisense; AGGTTGAACCAGTGATACTGCCCAC
>probe:Drosophila_2:1631996_at:353:29; Interrogation_Position=434; Antisense; ATACTGCCCACCAAGATTGAACTTC
>probe:Drosophila_2:1631996_at:167:235; Interrogation_Position=503; Antisense; AATCCCCAGATGAAGGTCCACTACA
>probe:Drosophila_2:1631996_at:683:707; Interrogation_Position=582; Antisense; TTAACTTTGCCCTTGGTGTGGGCCA
>probe:Drosophila_2:1631996_at:161:415; Interrogation_Position=619; Antisense; GAGCGCCAAGCTTTACGAAGGATTA
>probe:Drosophila_2:1631996_at:234:605; Interrogation_Position=96; Antisense; TGATCAAGTACATCGGTCGCACCAC

Paste this into a BLAST search page for me
AGACTTTCGCGGCAACACGCTGTGGTGTGGGAGCTGGTCTCAAACCTGCCTGTGGGCCGTCTGCTAATACGTAACACGTAACATGTTCCAGCGATATCCGAGCCCTGCTACATGCGGATTCTGAAGCGTAACGCAGCCAAAGCCTGTGGAGCACCAGCTATAAGGCGGACTACGAGGACTACGAACTGGTGCCGCAGGATAGGTTGAACCAGTGATACTGCCCACATACTGCCCACCAAGATTGAACTTCAATCCCCAGATGAAGGTCCACTACATTAACTTTGCCCTTGGTGTGGGCCAGAGCGCCAAGCTTTACGAAGGATTATGATCAAGTACATCGGTCGCACCAC

Full Affymetrix probeset data:

Annotations for 1631996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720