FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631998_at:

>probe:Drosophila_2:1631998_at:408:677; Interrogation_Position=150; Antisense; TAGACAGAGGATGGCCGCACTGACT
>probe:Drosophila_2:1631998_at:359:355; Interrogation_Position=166; Antisense; GCACTGACTCCACGAATCATCAAGG
>probe:Drosophila_2:1631998_at:553:423; Interrogation_Position=190; Antisense; GAGACACAGCGCCTTCTGGAGGACC
>probe:Drosophila_2:1631998_at:599:679; Interrogation_Position=228; Antisense; TAGTGCCACGCCTGATGAGTGTAAT
>probe:Drosophila_2:1631998_at:458:515; Interrogation_Position=246; Antisense; GTGTAATGCGCGTTATTTCCACGTC
>probe:Drosophila_2:1631998_at:657:15; Interrogation_Position=327; Antisense; ATTTTTACCCGAAGACTATCCTATG
>probe:Drosophila_2:1631998_at:471:95; Interrogation_Position=380; Antisense; AGATTTTCCATCCAAACATCGACCG
>probe:Drosophila_2:1631998_at:524:517; Interrogation_Position=406; Antisense; GTGGGTCGAATTTGTCTGGACATCC
>probe:Drosophila_2:1631998_at:553:227; Interrogation_Position=440; Antisense; AATGGAGTCCTGCTTTGCAAATTCG
>probe:Drosophila_2:1631998_at:202:615; Interrogation_Position=455; Antisense; TGCAAATTCGTACCGTTCTTCTTTC
>probe:Drosophila_2:1631998_at:453:629; Interrogation_Position=482; Antisense; TCCAGGCCCTGTTGAGTGCTCCAAA
>probe:Drosophila_2:1631998_at:315:99; Interrogation_Position=510; Antisense; AGATGATCCACTGGCCAACGACGTT
>probe:Drosophila_2:1631998_at:693:367; Interrogation_Position=546; Antisense; GAAGGTCAACGAGCGTAGGGCCATT
>probe:Drosophila_2:1631998_at:554:473; Interrogation_Position=560; Antisense; GTAGGGCCATTCAACTTGCTAGGGA

Paste this into a BLAST search page for me
TAGACAGAGGATGGCCGCACTGACTGCACTGACTCCACGAATCATCAAGGGAGACACAGCGCCTTCTGGAGGACCTAGTGCCACGCCTGATGAGTGTAATGTGTAATGCGCGTTATTTCCACGTCATTTTTACCCGAAGACTATCCTATGAGATTTTCCATCCAAACATCGACCGGTGGGTCGAATTTGTCTGGACATCCAATGGAGTCCTGCTTTGCAAATTCGTGCAAATTCGTACCGTTCTTCTTTCTCCAGGCCCTGTTGAGTGCTCCAAAAGATGATCCACTGGCCAACGACGTTGAAGGTCAACGAGCGTAGGGCCATTGTAGGGCCATTCAACTTGCTAGGGA

Full Affymetrix probeset data:

Annotations for 1631998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720