Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631999_at:

>probe:Drosophila_2:1631999_at:84:597; Interrogation_Position=2078; Antisense; TGTCCCGGTCACACGCAAAGTAAGT
>probe:Drosophila_2:1631999_at:597:291; Interrogation_Position=2120; Antisense; CGTAAGCGAAGATCCTCCAAGCGAT
>probe:Drosophila_2:1631999_at:318:95; Interrogation_Position=2181; Antisense; AGAAAGGCTTTCTCATCCAAACCCA
>probe:Drosophila_2:1631999_at:458:319; Interrogation_Position=2219; Antisense; GCCGAAGGTGCTACCTATTGCAAAT
>probe:Drosophila_2:1631999_at:604:337; Interrogation_Position=2251; Antisense; GCTAAAGAAGTTCACGCGCTACCTT
>probe:Drosophila_2:1631999_at:555:563; Interrogation_Position=2286; Antisense; GGAAGGATCACATACCCGAGAGCGA
>probe:Drosophila_2:1631999_at:467:417; Interrogation_Position=2305; Antisense; GAGCGATCTGGCCAAGCACCAAAAT
>probe:Drosophila_2:1631999_at:184:209; Interrogation_Position=2318; Antisense; AAGCACCAAAATGCCTCGCGGGAGG
>probe:Drosophila_2:1631999_at:149:105; Interrogation_Position=2379; Antisense; AGACGACATAGAGCTGCGGCCAGGA
>probe:Drosophila_2:1631999_at:143:711; Interrogation_Position=2447; Antisense; TTAAGATCAGCTAATGGCCGGCCCA
>probe:Drosophila_2:1631999_at:664:307; Interrogation_Position=2469; Antisense; CCAGCTTCGGTTGCGGTTGCCAGTT
>probe:Drosophila_2:1631999_at:111:589; Interrogation_Position=2499; Antisense; TGGAGAACAGCAACCCATGCCGATT
>probe:Drosophila_2:1631999_at:589:573; Interrogation_Position=2535; Antisense; GGCTGTCCAACAACGCGATCAATGA
>probe:Drosophila_2:1631999_at:368:341; Interrogation_Position=2571; Antisense; GCTTCCTAGTCGTTCATCAGTTTTT

Paste this into a BLAST search page for me
TGTCCCGGTCACACGCAAAGTAAGTCGTAAGCGAAGATCCTCCAAGCGATAGAAAGGCTTTCTCATCCAAACCCAGCCGAAGGTGCTACCTATTGCAAATGCTAAAGAAGTTCACGCGCTACCTTGGAAGGATCACATACCCGAGAGCGAGAGCGATCTGGCCAAGCACCAAAATAAGCACCAAAATGCCTCGCGGGAGGAGACGACATAGAGCTGCGGCCAGGATTAAGATCAGCTAATGGCCGGCCCACCAGCTTCGGTTGCGGTTGCCAGTTTGGAGAACAGCAACCCATGCCGATTGGCTGTCCAACAACGCGATCAATGAGCTTCCTAGTCGTTCATCAGTTTTT

Full Affymetrix probeset data:

Annotations for 1631999_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime