FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632001_at:

>probe:Drosophila_2:1632001_at:307:11; Interrogation_Position=1468; Antisense; ATTCTGGAGCCTTTCATCGTTATTG
>probe:Drosophila_2:1632001_at:434:43; Interrogation_Position=1483; Antisense; ATCGTTATTGCGACGGCGTGGCTCC
>probe:Drosophila_2:1632001_at:709:519; Interrogation_Position=1500; Antisense; GTGGCTCCTTGCATGGTTATTGGCT
>probe:Drosophila_2:1632001_at:484:703; Interrogation_Position=1516; Antisense; TTATTGGCTTGGGATCGCATGGAGA
>probe:Drosophila_2:1632001_at:619:457; Interrogation_Position=1594; Antisense; GATATGTTCAGTCCGAGCGAGCCTT
>probe:Drosophila_2:1632001_at:2:277; Interrogation_Position=1622; Antisense; CTTTGCCTTGAATCCAGCCAATGGG
>probe:Drosophila_2:1632001_at:586:23; Interrogation_Position=1682; Antisense; ATATGCCATTTGCTATCATCCTGAT
>probe:Drosophila_2:1632001_at:69:37; Interrogation_Position=1696; Antisense; ATCATCCTGATTGCGGTCCCATTTT
>probe:Drosophila_2:1632001_at:368:503; Interrogation_Position=1711; Antisense; GTCCCATTTTTGGTGCTGGAGCCGA
>probe:Drosophila_2:1632001_at:92:453; Interrogation_Position=1734; Antisense; GATCTGCTCATTTCCAGCAACTGTA
>probe:Drosophila_2:1632001_at:423:63; Interrogation_Position=1767; Antisense; ATGGACTCATACTCGAATCTTCCGC
>probe:Drosophila_2:1632001_at:616:557; Interrogation_Position=1835; Antisense; GGACTATAACTTTACCATCACCGAC
>probe:Drosophila_2:1632001_at:439:403; Interrogation_Position=1857; Antisense; GACTATGAGGTCTATACCCTTTCCT
>probe:Drosophila_2:1632001_at:529:611; Interrogation_Position=1933; Antisense; TGAACCACTCAACAAACGGCCAAGC

Paste this into a BLAST search page for me
ATTCTGGAGCCTTTCATCGTTATTGATCGTTATTGCGACGGCGTGGCTCCGTGGCTCCTTGCATGGTTATTGGCTTTATTGGCTTGGGATCGCATGGAGAGATATGTTCAGTCCGAGCGAGCCTTCTTTGCCTTGAATCCAGCCAATGGGATATGCCATTTGCTATCATCCTGATATCATCCTGATTGCGGTCCCATTTTGTCCCATTTTTGGTGCTGGAGCCGAGATCTGCTCATTTCCAGCAACTGTAATGGACTCATACTCGAATCTTCCGCGGACTATAACTTTACCATCACCGACGACTATGAGGTCTATACCCTTTCCTTGAACCACTCAACAAACGGCCAAGC

Full Affymetrix probeset data:

Annotations for 1632001_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720