Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632007_at:

>probe:Drosophila_2:1632007_at:95:101; Interrogation_Position=2081; Antisense; AGAGGAACTGGCTGCTCCAGCTGGA
>probe:Drosophila_2:1632007_at:155:587; Interrogation_Position=2102; Antisense; TGGACTTTGCCCAACAGAGCGGAAA
>probe:Drosophila_2:1632007_at:397:155; Interrogation_Position=2194; Antisense; ACAGACAGTGCGAGCGGCAGTTCAA
>probe:Drosophila_2:1632007_at:83:493; Interrogation_Position=2305; Antisense; GTAACAGCATCTGTTGCCACGTTGC
>probe:Drosophila_2:1632007_at:597:469; Interrogation_Position=2325; Antisense; GTTGCCGACTTTTGTTTACCTCTCT
>probe:Drosophila_2:1632007_at:349:707; Interrogation_Position=2340; Antisense; TTACCTCTCTCGTTTGGCGCATTAT
>probe:Drosophila_2:1632007_at:431:323; Interrogation_Position=2356; Antisense; GCGCATTATCTACTGCATACCATTA
>probe:Drosophila_2:1632007_at:552:667; Interrogation_Position=2366; Antisense; TACTGCATACCATTACGACTACGAC
>probe:Drosophila_2:1632007_at:386:137; Interrogation_Position=2386; Antisense; ACGACTATGTTCACGTTCGTTCCAT
>probe:Drosophila_2:1632007_at:669:291; Interrogation_Position=2419; Antisense; CGTGCTTCATCTAGGGTTCTGTATA
>probe:Drosophila_2:1632007_at:602:339; Interrogation_Position=2448; Antisense; GCTTAGTTTCTTGCGGAAGTTCCGG
>probe:Drosophila_2:1632007_at:93:471; Interrogation_Position=2466; Antisense; GTTCCGGTTCGGTGAATGATGCTAT
>probe:Drosophila_2:1632007_at:107:499; Interrogation_Position=2496; Antisense; GTCTCAAATCTCTATTGTGGCCCAG
>probe:Drosophila_2:1632007_at:636:329; Interrogation_Position=2538; Antisense; GCGGCCTGCTTATTAAACGGGTCTG

Paste this into a BLAST search page for me
AGAGGAACTGGCTGCTCCAGCTGGATGGACTTTGCCCAACAGAGCGGAAAACAGACAGTGCGAGCGGCAGTTCAAGTAACAGCATCTGTTGCCACGTTGCGTTGCCGACTTTTGTTTACCTCTCTTTACCTCTCTCGTTTGGCGCATTATGCGCATTATCTACTGCATACCATTATACTGCATACCATTACGACTACGACACGACTATGTTCACGTTCGTTCCATCGTGCTTCATCTAGGGTTCTGTATAGCTTAGTTTCTTGCGGAAGTTCCGGGTTCCGGTTCGGTGAATGATGCTATGTCTCAAATCTCTATTGTGGCCCAGGCGGCCTGCTTATTAAACGGGTCTG

Full Affymetrix probeset data:

Annotations for 1632007_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime