FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632009_at:

>probe:Drosophila_2:1632009_at:528:301; Interrogation_Position=388; Antisense; CCGACATTGACGAGAGTAGGTGCCA
>probe:Drosophila_2:1632009_at:430:135; Interrogation_Position=397; Antisense; ACGAGAGTAGGTGCCAGGTCTTCTA
>probe:Drosophila_2:1632009_at:315:483; Interrogation_Position=403; Antisense; GTAGGTGCCAGGTCTTCTAGGGAAC
>probe:Drosophila_2:1632009_at:51:487; Interrogation_Position=407; Antisense; GTGCCAGGTCTTCTAGGGAACCTAC
>probe:Drosophila_2:1632009_at:395:513; Interrogation_Position=413; Antisense; GGTCTTCTAGGGAACCTACGCCACA
>probe:Drosophila_2:1632009_at:719:643; Interrogation_Position=418; Antisense; TCTAGGGAACCTACGCCACAGACTA
>probe:Drosophila_2:1632009_at:613:551; Interrogation_Position=423; Antisense; GGAACCTACGCCACAGACTACTTTA
>probe:Drosophila_2:1632009_at:545:129; Interrogation_Position=426; Antisense; ACCTACGCCACAGACTACTTTAAAG
>probe:Drosophila_2:1632009_at:1:135; Interrogation_Position=430; Antisense; ACGCCACAGACTACTTTAAAGCATT
>probe:Drosophila_2:1632009_at:386:401; Interrogation_Position=438; Antisense; GACTACTTTAAAGCATTCTTCTTCA
>probe:Drosophila_2:1632009_at:445:173; Interrogation_Position=447; Antisense; AAAGCATTCTTCTTCATGTTATCCT
>probe:Drosophila_2:1632009_at:684:343; Interrogation_Position=450; Antisense; GCATTCTTCTTCATGTTATCCTTAC
>probe:Drosophila_2:1632009_at:681:643; Interrogation_Position=454; Antisense; TCTTCTTCATGTTATCCTTACAGAT
>probe:Drosophila_2:1632009_at:702:47; Interrogation_Position=467; Antisense; ATCCTTACAGATAGTGGCAGCGATC

Paste this into a BLAST search page for me
CCGACATTGACGAGAGTAGGTGCCAACGAGAGTAGGTGCCAGGTCTTCTAGTAGGTGCCAGGTCTTCTAGGGAACGTGCCAGGTCTTCTAGGGAACCTACGGTCTTCTAGGGAACCTACGCCACATCTAGGGAACCTACGCCACAGACTAGGAACCTACGCCACAGACTACTTTAACCTACGCCACAGACTACTTTAAAGACGCCACAGACTACTTTAAAGCATTGACTACTTTAAAGCATTCTTCTTCAAAAGCATTCTTCTTCATGTTATCCTGCATTCTTCTTCATGTTATCCTTACTCTTCTTCATGTTATCCTTACAGATATCCTTACAGATAGTGGCAGCGATC

Full Affymetrix probeset data:

Annotations for 1632009_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720