FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632011_at:

>probe:Drosophila_2:1632011_at:520:401; Interrogation_Position=1008; Antisense; GACTATTTTTAACCGTCCGCTGGAT
>probe:Drosophila_2:1632011_at:35:351; Interrogation_Position=1057; Antisense; GCAGTCGTCGATTGCACCTACAGTG
>probe:Drosophila_2:1632011_at:127:355; Interrogation_Position=1070; Antisense; GCACCTACAGTGCTATGCAAGTAAA
>probe:Drosophila_2:1632011_at:316:345; Interrogation_Position=1098; Antisense; GCATATGGTTATTGCCATGTACGTA
>probe:Drosophila_2:1632011_at:436:247; Interrogation_Position=1134; Antisense; AATTGTATGACGATGGACACGCACA
>probe:Drosophila_2:1632011_at:8:559; Interrogation_Position=1148; Antisense; GGACACGCACAAACCTAGTGAGAAT
>probe:Drosophila_2:1632011_at:57:431; Interrogation_Position=1209; Antisense; GAGTCAATGACCTCAGCGAATAGTC
>probe:Drosophila_2:1632011_at:172:475; Interrogation_Position=1236; Antisense; GTATACAATAGGCACCATCTTCAGA
>probe:Drosophila_2:1632011_at:238:231; Interrogation_Position=1264; Antisense; AATGTTCTTCGACTTATTCTGAATG
>probe:Drosophila_2:1632011_at:34:369; Interrogation_Position=1284; Antisense; GAATGTCGTTCAGTGCCCGATTAAT
>probe:Drosophila_2:1632011_at:85:317; Interrogation_Position=1298; Antisense; GCCCGATTAATTTTACGGATGTAAG
>probe:Drosophila_2:1632011_at:502:443; Interrogation_Position=1315; Antisense; GATGTAAGCACATGGGCACGAGTTA
>probe:Drosophila_2:1632011_at:680:539; Interrogation_Position=974; Antisense; GGTATTCCACTGATTGCATTCTGTC
>probe:Drosophila_2:1632011_at:256:345; Interrogation_Position=989; Antisense; GCATTCTGTCCCATTGTTGGACTAT

Paste this into a BLAST search page for me
GACTATTTTTAACCGTCCGCTGGATGCAGTCGTCGATTGCACCTACAGTGGCACCTACAGTGCTATGCAAGTAAAGCATATGGTTATTGCCATGTACGTAAATTGTATGACGATGGACACGCACAGGACACGCACAAACCTAGTGAGAATGAGTCAATGACCTCAGCGAATAGTCGTATACAATAGGCACCATCTTCAGAAATGTTCTTCGACTTATTCTGAATGGAATGTCGTTCAGTGCCCGATTAATGCCCGATTAATTTTACGGATGTAAGGATGTAAGCACATGGGCACGAGTTAGGTATTCCACTGATTGCATTCTGTCGCATTCTGTCCCATTGTTGGACTAT

Full Affymetrix probeset data:

Annotations for 1632011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720