FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632015_at:

>probe:Drosophila_2:1632015_at:446:327; Interrogation_Position=239; Antisense; GCGATGCGCCAGAGTTCAAGCTGAT
>probe:Drosophila_2:1632015_at:602:611; Interrogation_Position=281; Antisense; TGACAGTCGGAGTGTTGCCCAAATT
>probe:Drosophila_2:1632015_at:14:163; Interrogation_Position=301; Antisense; AAATTCGATCCGTTCATTTCGGGCG
>probe:Drosophila_2:1632015_at:344:137; Interrogation_Position=347; Antisense; ACGACTATCTCGAGGCAAATTGCAG
>probe:Drosophila_2:1632015_at:336:427; Interrogation_Position=376; Antisense; GAGATGTCAAGTCCGATGGCCAAAT
>probe:Drosophila_2:1632015_at:355:239; Interrogation_Position=418; Antisense; AATAAGACGGCACCTGGGCACAGTT
>probe:Drosophila_2:1632015_at:160:725; Interrogation_Position=442; Antisense; TTGCAGCCGCAAATCAACGAAGTCT
>probe:Drosophila_2:1632015_at:447:219; Interrogation_Position=461; Antisense; AAGTCTCACGCAACGTGGACGGCTT
>probe:Drosophila_2:1632015_at:483:137; Interrogation_Position=527; Antisense; ACGACCAGCGGTTCATCAGCAAGAG
>probe:Drosophila_2:1632015_at:344:167; Interrogation_Position=554; Antisense; AAATGTTGGAGCTCCGCTGCACGGC
>probe:Drosophila_2:1632015_at:595:401; Interrogation_Position=580; Antisense; GACATCATGGGACTGGCAGCCGTTA
>probe:Drosophila_2:1632015_at:540:549; Interrogation_Position=609; Antisense; GGAGAGCAGGGTACGGACCACCATC
>probe:Drosophila_2:1632015_at:282:209; Interrogation_Position=658; Antisense; AAGCAGCGACTCACCGAGAACGGAT
>probe:Drosophila_2:1632015_at:499:383; Interrogation_Position=675; Antisense; GAACGGATCCTGCATGACCGGCCAA

Paste this into a BLAST search page for me
GCGATGCGCCAGAGTTCAAGCTGATTGACAGTCGGAGTGTTGCCCAAATTAAATTCGATCCGTTCATTTCGGGCGACGACTATCTCGAGGCAAATTGCAGGAGATGTCAAGTCCGATGGCCAAATAATAAGACGGCACCTGGGCACAGTTTTGCAGCCGCAAATCAACGAAGTCTAAGTCTCACGCAACGTGGACGGCTTACGACCAGCGGTTCATCAGCAAGAGAAATGTTGGAGCTCCGCTGCACGGCGACATCATGGGACTGGCAGCCGTTAGGAGAGCAGGGTACGGACCACCATCAAGCAGCGACTCACCGAGAACGGATGAACGGATCCTGCATGACCGGCCAA

Full Affymetrix probeset data:

Annotations for 1632015_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720