Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632017_at:

>probe:Drosophila_2:1632017_at:573:549; Interrogation_Position=1179; Antisense; GGAGTCTCCGGATCTTCGAAGGCGA
>probe:Drosophila_2:1632017_at:220:371; Interrogation_Position=1196; Antisense; GAAGGCGAGGCCATCGTCTGTGAAA
>probe:Drosophila_2:1632017_at:636:611; Interrogation_Position=1216; Antisense; TGAAAGTGCGACCAGCGAGACCCGT
>probe:Drosophila_2:1632017_at:517:471; Interrogation_Position=1251; Antisense; GTTCGTCCCGCATTGGAAATCGATG
>probe:Drosophila_2:1632017_at:505:395; Interrogation_Position=1266; Antisense; GAAATCGATGAACTGTCGGCTCCCA
>probe:Drosophila_2:1632017_at:286:213; Interrogation_Position=1297; Antisense; AAGAGCTAACCATGTCCACCTATAC
>probe:Drosophila_2:1632017_at:185:29; Interrogation_Position=1325; Antisense; ATACGTGTGCCGCAACAAGCCAGAT
>probe:Drosophila_2:1632017_at:697:613; Interrogation_Position=1369; Antisense; TGAAGAGCTGCTCCGACTACTATAT
>probe:Drosophila_2:1632017_at:605:259; Interrogation_Position=1411; Antisense; CACTGTTGGTGAGCTGCGGCGATAA
>probe:Drosophila_2:1632017_at:533:221; Interrogation_Position=1452; Antisense; AAGGGCATTTGCGATCTGCCCGAGA
>probe:Drosophila_2:1632017_at:71:329; Interrogation_Position=1481; Antisense; GCGTTGCGTGCAGCCACAAGCATAA
>probe:Drosophila_2:1632017_at:302:661; Interrogation_Position=1503; Antisense; TAAAACTTGACGATGGCTTCCTAAT
>probe:Drosophila_2:1632017_at:548:261; Interrogation_Position=1560; Antisense; CACCTTGATATTTGTGCCCGATCGA
>probe:Drosophila_2:1632017_at:500:507; Interrogation_Position=1573; Antisense; GTGCCCGATCGATTCTTTATCATAT

Paste this into a BLAST search page for me
GGAGTCTCCGGATCTTCGAAGGCGAGAAGGCGAGGCCATCGTCTGTGAAATGAAAGTGCGACCAGCGAGACCCGTGTTCGTCCCGCATTGGAAATCGATGGAAATCGATGAACTGTCGGCTCCCAAAGAGCTAACCATGTCCACCTATACATACGTGTGCCGCAACAAGCCAGATTGAAGAGCTGCTCCGACTACTATATCACTGTTGGTGAGCTGCGGCGATAAAAGGGCATTTGCGATCTGCCCGAGAGCGTTGCGTGCAGCCACAAGCATAATAAAACTTGACGATGGCTTCCTAATCACCTTGATATTTGTGCCCGATCGAGTGCCCGATCGATTCTTTATCATAT

Full Affymetrix probeset data:

Annotations for 1632017_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime