FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632021_at:

>probe:Drosophila_2:1632021_at:240:451; Interrogation_Position=1214; Antisense; GATCGTACCCACACTGGCCATACAT
>probe:Drosophila_2:1632021_at:54:629; Interrogation_Position=1244; Antisense; TCCAGAGTTTTATCCAGAGCCCGAG
>probe:Drosophila_2:1632021_at:88:417; Interrogation_Position=1260; Antisense; GAGCCCGAGAAGTTTATTCCAGAGC
>probe:Drosophila_2:1632021_at:161:445; Interrogation_Position=1290; Antisense; GATGAGGATCAGGTGCAACAGCGTC
>probe:Drosophila_2:1632021_at:638:623; Interrogation_Position=1330; Antisense; TGCCCTTTGGTGATGGTCCTAGGAA
>probe:Drosophila_2:1632021_at:648:41; Interrogation_Position=1359; Antisense; ATCGGTCTTCGATTTGGTCGGATGC
>probe:Drosophila_2:1632021_at:511:349; Interrogation_Position=1382; Antisense; GCAGGTCATAGTTGGCATGGCCTTG
>probe:Drosophila_2:1632021_at:20:569; Interrogation_Position=1395; Antisense; GGCATGGCCTTGTTAATCCACAACT
>probe:Drosophila_2:1632021_at:684:255; Interrogation_Position=1442; Antisense; CAAAACTGTCGTTCCCTTAGAATAT
>probe:Drosophila_2:1632021_at:497:555; Interrogation_Position=1468; Antisense; GGACCGATGATTTTCTACTGAGCTC
>probe:Drosophila_2:1632021_at:240:639; Interrogation_Position=1481; Antisense; TCTACTGAGCTCGAAGGGCGGAATT
>probe:Drosophila_2:1632021_at:242:293; Interrogation_Position=1496; Antisense; GGGCGGAATTCACCTAAAAGTCACT
>probe:Drosophila_2:1632021_at:659:661; Interrogation_Position=1562; Antisense; TAAAGCTTTGTTCTTGCGACGTAAA
>probe:Drosophila_2:1632021_at:209:685; Interrogation_Position=1662; Antisense; TATACCTTTTACATCACCTACAGTG

Paste this into a BLAST search page for me
GATCGTACCCACACTGGCCATACATTCCAGAGTTTTATCCAGAGCCCGAGGAGCCCGAGAAGTTTATTCCAGAGCGATGAGGATCAGGTGCAACAGCGTCTGCCCTTTGGTGATGGTCCTAGGAAATCGGTCTTCGATTTGGTCGGATGCGCAGGTCATAGTTGGCATGGCCTTGGGCATGGCCTTGTTAATCCACAACTCAAAACTGTCGTTCCCTTAGAATATGGACCGATGATTTTCTACTGAGCTCTCTACTGAGCTCGAAGGGCGGAATTGGGCGGAATTCACCTAAAAGTCACTTAAAGCTTTGTTCTTGCGACGTAAATATACCTTTTACATCACCTACAGTG

Full Affymetrix probeset data:

Annotations for 1632021_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720