FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632024_at:

>probe:Drosophila_2:1632024_at:641:159; Interrogation_Position=1026; Antisense; ACAAGCGGTCAATCATCTGGAGCAC
>probe:Drosophila_2:1632024_at:695:227; Interrogation_Position=1081; Antisense; AATGGCCAACATCAGGGCGTTCCCA
>probe:Drosophila_2:1632024_at:505:327; Interrogation_Position=1121; Antisense; GCGATCACTATCAGCCATTGTTTGG
>probe:Drosophila_2:1632024_at:547:3; Interrogation_Position=1137; Antisense; ATTGTTTGGCAATGCCGGCACCACT
>probe:Drosophila_2:1632024_at:362:269; Interrogation_Position=1190; Antisense; CATCGCACCGGCAAGACGACGAGTA
>probe:Drosophila_2:1632024_at:373:137; Interrogation_Position=1205; Antisense; ACGACGAGTACGATGCCATTGGCGT
>probe:Drosophila_2:1632024_at:29:231; Interrogation_Position=1231; Antisense; AATGTGGCGAGCAAACTGCGCTCCA
>probe:Drosophila_2:1632024_at:96:195; Interrogation_Position=1286; Antisense; AACTGATCAGCGACGTTCTATTCAA
>probe:Drosophila_2:1632024_at:648:711; Interrogation_Position=1301; Antisense; TTCTATTCAACGCACAGCTGGGCAA
>probe:Drosophila_2:1632024_at:431:89; Interrogation_Position=1379; Antisense; AGTATGTGTAGTCTCTGGCTTTATA
>probe:Drosophila_2:1632024_at:434:687; Interrogation_Position=1400; Antisense; TATATCTCCATTTTGTCTGTGTCCC
>probe:Drosophila_2:1632024_at:58:569; Interrogation_Position=1456; Antisense; GGCAGCAGCCGATTGTACCATACAG
>probe:Drosophila_2:1632024_at:504:337; Interrogation_Position=958; Antisense; GCTCAGGGACATGCCGTGAAGGTCT
>probe:Drosophila_2:1632024_at:625:371; Interrogation_Position=975; Antisense; GAAGGTCTTAGAGATCACCTCCCTA

Paste this into a BLAST search page for me
ACAAGCGGTCAATCATCTGGAGCACAATGGCCAACATCAGGGCGTTCCCAGCGATCACTATCAGCCATTGTTTGGATTGTTTGGCAATGCCGGCACCACTCATCGCACCGGCAAGACGACGAGTAACGACGAGTACGATGCCATTGGCGTAATGTGGCGAGCAAACTGCGCTCCAAACTGATCAGCGACGTTCTATTCAATTCTATTCAACGCACAGCTGGGCAAAGTATGTGTAGTCTCTGGCTTTATATATATCTCCATTTTGTCTGTGTCCCGGCAGCAGCCGATTGTACCATACAGGCTCAGGGACATGCCGTGAAGGTCTGAAGGTCTTAGAGATCACCTCCCTA

Full Affymetrix probeset data:

Annotations for 1632024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720