FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632026_at:

>probe:Drosophila_2:1632026_at:601:435; Interrogation_Position=1037; Antisense; GAGGTTCTCACCAAAGAGCTTCTCG
>probe:Drosophila_2:1632026_at:452:213; Interrogation_Position=1050; Antisense; AAGAGCTTCTCGACTTTTGGCGCGA
>probe:Drosophila_2:1632026_at:139:169; Interrogation_Position=1086; Antisense; AAATGGAACTTGGTCCCAGTTGCGC
>probe:Drosophila_2:1632026_at:35:79; Interrogation_Position=1137; Antisense; AGGATCCGCTGCCATTCGAGTTTTA
>probe:Drosophila_2:1632026_at:89:389; Interrogation_Position=1163; Antisense; GAAAAGGCTGGTTGCAAGGCTCCCT
>probe:Drosophila_2:1632026_at:260:251; Interrogation_Position=1177; Antisense; CAAGGCTCCCTTTGAAGGACCTGTA
>probe:Drosophila_2:1632026_at:180:261; Interrogation_Position=1260; Antisense; CACCTATTCTGGTCGTAATCTCTGA
>probe:Drosophila_2:1632026_at:7:657; Interrogation_Position=807; Antisense; TAATGAAGCGCTTTGTTCTGACCAA
>probe:Drosophila_2:1632026_at:26:185; Interrogation_Position=830; Antisense; AAAATCATCGTTCCGGACAGCGTTC
>probe:Drosophila_2:1632026_at:505:331; Interrogation_Position=878; Antisense; GCGGCAGCCGCCAGGGAGATAATCT
>probe:Drosophila_2:1632026_at:571:237; Interrogation_Position=898; Antisense; AATCTGGAAGCTGCTCTTCGATGGC
>probe:Drosophila_2:1632026_at:82:435; Interrogation_Position=935; Antisense; GAGGATCAAAACAAGGCCGCCGAGC
>probe:Drosophila_2:1632026_at:467:605; Interrogation_Position=979; Antisense; TGATGCTGGTTTCTATGGGCCCGAC
>probe:Drosophila_2:1632026_at:577:523; Interrogation_Position=995; Antisense; GGGCCCGACGACTACAACAGTTGGA

Paste this into a BLAST search page for me
GAGGTTCTCACCAAAGAGCTTCTCGAAGAGCTTCTCGACTTTTGGCGCGAAAATGGAACTTGGTCCCAGTTGCGCAGGATCCGCTGCCATTCGAGTTTTAGAAAAGGCTGGTTGCAAGGCTCCCTCAAGGCTCCCTTTGAAGGACCTGTACACCTATTCTGGTCGTAATCTCTGATAATGAAGCGCTTTGTTCTGACCAAAAAATCATCGTTCCGGACAGCGTTCGCGGCAGCCGCCAGGGAGATAATCTAATCTGGAAGCTGCTCTTCGATGGCGAGGATCAAAACAAGGCCGCCGAGCTGATGCTGGTTTCTATGGGCCCGACGGGCCCGACGACTACAACAGTTGGA

Full Affymetrix probeset data:

Annotations for 1632026_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720