Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632028_a_at:

>probe:Drosophila_2:1632028_a_at:453:437; Interrogation_Position=116; Antisense; GAGGAGTACGCACGCCAGCAGCGCG
>probe:Drosophila_2:1632028_a_at:594:287; Interrogation_Position=13; Antisense; CGGCAAGACATATCCCTTTGAGATC
>probe:Drosophila_2:1632028_a_at:161:125; Interrogation_Position=135; Antisense; AGCGCGCCAACACCGAGATCCTGAT
>probe:Drosophila_2:1632028_a_at:460:187; Interrogation_Position=143; Antisense; AACACCGAGATCCTGATGCGGAACG
>probe:Drosophila_2:1632028_a_at:268:449; Interrogation_Position=151; Antisense; GATCCTGATGCGGAACGCCCAGTTG
>probe:Drosophila_2:1632028_a_at:103:331; Interrogation_Position=160; Antisense; GCGGAACGCCCAGTTGATGCCAGGT
>probe:Drosophila_2:1632028_a_at:432:105; Interrogation_Position=18; Antisense; AGACATATCCCTTTGAGATCAAGGA
>probe:Drosophila_2:1632028_a_at:490:33; Interrogation_Position=35; Antisense; ATCAAGGAGCAGGTCATGGGCCTGC
>probe:Drosophila_2:1632028_a_at:389:65; Interrogation_Position=45; Antisense; AGGTCATGGGCCTGCAGACGGAACC
>probe:Drosophila_2:1632028_a_at:686:507; Interrogation_Position=558; Antisense; GTGCTGAGCGCCTGCTGCGTCACCT
>probe:Drosophila_2:1632028_a_at:582:69; Interrogation_Position=60; Antisense; AGACGGAACCGCTGGCCCGGTTCAT
>probe:Drosophila_2:1632028_a_at:634:581; Interrogation_Position=72; Antisense; TGGCCCGGTTCATGGTCGAGCACTA
>probe:Drosophila_2:1632028_a_at:485:65; Interrogation_Position=83; Antisense; ATGGTCGAGCACTACGAGCTGCCGA
>probe:Drosophila_2:1632028_a_at:730:111; Interrogation_Position=90; Antisense; AGCACTACGAGCTGCCGATGTCGTG

Paste this into a BLAST search page for me
GAGGAGTACGCACGCCAGCAGCGCGCGGCAAGACATATCCCTTTGAGATCAGCGCGCCAACACCGAGATCCTGATAACACCGAGATCCTGATGCGGAACGGATCCTGATGCGGAACGCCCAGTTGGCGGAACGCCCAGTTGATGCCAGGTAGACATATCCCTTTGAGATCAAGGAATCAAGGAGCAGGTCATGGGCCTGCAGGTCATGGGCCTGCAGACGGAACCGTGCTGAGCGCCTGCTGCGTCACCTAGACGGAACCGCTGGCCCGGTTCATTGGCCCGGTTCATGGTCGAGCACTAATGGTCGAGCACTACGAGCTGCCGAAGCACTACGAGCTGCCGATGTCGTG

Full Affymetrix probeset data:

Annotations for 1632028_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime