FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632030_at:

>probe:Drosophila_2:1632030_at:289:545; Interrogation_Position=1015; Antisense; GGATCATTTGGCCTTCTACACTTTC
>probe:Drosophila_2:1632030_at:73:243; Interrogation_Position=1042; Antisense; AATACCACGGTGTCTCTGTATCTGA
>probe:Drosophila_2:1632030_at:534:373; Interrogation_Position=1071; Antisense; GAAGTCCTTGCAACTCTTGTACAAC
>probe:Drosophila_2:1632030_at:153:81; Interrogation_Position=1124; Antisense; AGGTGCCACATTTCTCCATGATTAT
>probe:Drosophila_2:1632030_at:222:61; Interrogation_Position=1147; Antisense; ATGTATGGATTTTTCACCGCCGTAC
>probe:Drosophila_2:1632030_at:313:667; Interrogation_Position=1169; Antisense; TACTCTGTCACTCAACGGTTCTGGA
>probe:Drosophila_2:1632030_at:553:269; Interrogation_Position=1203; Antisense; CATGCGGCCCAGTTACTTTAAGTTT
>probe:Drosophila_2:1632030_at:502:435; Interrogation_Position=1244; Antisense; GAGGTCGTCTAAGCCGGTTCAATAT
>probe:Drosophila_2:1632030_at:33:381; Interrogation_Position=1353; Antisense; GAACCCTCTATTTCCACTGATTGTT
>probe:Drosophila_2:1632030_at:127:709; Interrogation_Position=809; Antisense; TTCAAGTGGGTTTCAAGCTCCTGCT
>probe:Drosophila_2:1632030_at:356:675; Interrogation_Position=911; Antisense; TAGCGCTCGGCATATTTTCACTGCT
>probe:Drosophila_2:1632030_at:286:99; Interrogation_Position=941; Antisense; AGATGTCTTCATGTGGCTTGCGTCA
>probe:Drosophila_2:1632030_at:634:343; Interrogation_Position=956; Antisense; GCTTGCGTCACTCTTTTGGATATGA
>probe:Drosophila_2:1632030_at:151:459; Interrogation_Position=974; Antisense; GATATGATAACGCTCTCTTTGCCAT

Paste this into a BLAST search page for me
GGATCATTTGGCCTTCTACACTTTCAATACCACGGTGTCTCTGTATCTGAGAAGTCCTTGCAACTCTTGTACAACAGGTGCCACATTTCTCCATGATTATATGTATGGATTTTTCACCGCCGTACTACTCTGTCACTCAACGGTTCTGGACATGCGGCCCAGTTACTTTAAGTTTGAGGTCGTCTAAGCCGGTTCAATATGAACCCTCTATTTCCACTGATTGTTTTCAAGTGGGTTTCAAGCTCCTGCTTAGCGCTCGGCATATTTTCACTGCTAGATGTCTTCATGTGGCTTGCGTCAGCTTGCGTCACTCTTTTGGATATGAGATATGATAACGCTCTCTTTGCCAT

Full Affymetrix probeset data:

Annotations for 1632030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720