Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632032_at:

>probe:Drosophila_2:1632032_at:473:607; Interrogation_Position=2331; Antisense; TGAGCGTAGTTCACACCGCACCTGG
>probe:Drosophila_2:1632032_at:474:129; Interrogation_Position=2349; Antisense; CACCTGGGCGGGATTTTAGCCGGAT
>probe:Drosophila_2:1632032_at:396:187; Interrogation_Position=2404; Antisense; AACACTTGCACATCCCGGCGTGAGA
>probe:Drosophila_2:1632032_at:702:605; Interrogation_Position=2424; Antisense; TGAGAGGGAACGACGCCTACCGTGC
>probe:Drosophila_2:1632032_at:660:131; Interrogation_Position=2436; Antisense; ACGCCTACCGTGCAGAGCTAATTTA
>probe:Drosophila_2:1632032_at:392:243; Interrogation_Position=2455; Antisense; AATTTAAGTCAACCGGCTGCACACA
>probe:Drosophila_2:1632032_at:417:17; Interrogation_Position=2593; Antisense; ATTTAGTGCCGTGATTTTTCGCGCT
>probe:Drosophila_2:1632032_at:108:299; Interrogation_Position=2614; Antisense; CGCTTTTCCCCTAGCAATTTTGAGA
>probe:Drosophila_2:1632032_at:269:725; Interrogation_Position=2633; Antisense; TTGAGATTACGCACTTGAGCCAATT
>probe:Drosophila_2:1632032_at:479:413; Interrogation_Position=2649; Antisense; GAGCCAATTTTGTTTACCCTGTTGT
>probe:Drosophila_2:1632032_at:481:673; Interrogation_Position=2688; Antisense; TAGCCATTACATCACGAGTTCAGTT
>probe:Drosophila_2:1632032_at:560:163; Interrogation_Position=2732; Antisense; AAATTTCTCTTGAGCAGCCGTCAAC
>probe:Drosophila_2:1632032_at:89:197; Interrogation_Position=2759; Antisense; AACTGGCCTGTTTGCGTATTTACTT
>probe:Drosophila_2:1632032_at:41:207; Interrogation_Position=2828; Antisense; AAGCGTTGTCTAACAGGCTGCTGTT

Paste this into a BLAST search page for me
TGAGCGTAGTTCACACCGCACCTGGCACCTGGGCGGGATTTTAGCCGGATAACACTTGCACATCCCGGCGTGAGATGAGAGGGAACGACGCCTACCGTGCACGCCTACCGTGCAGAGCTAATTTAAATTTAAGTCAACCGGCTGCACACAATTTAGTGCCGTGATTTTTCGCGCTCGCTTTTCCCCTAGCAATTTTGAGATTGAGATTACGCACTTGAGCCAATTGAGCCAATTTTGTTTACCCTGTTGTTAGCCATTACATCACGAGTTCAGTTAAATTTCTCTTGAGCAGCCGTCAACAACTGGCCTGTTTGCGTATTTACTTAAGCGTTGTCTAACAGGCTGCTGTT

Full Affymetrix probeset data:

Annotations for 1632032_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime