FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632034_at:

>probe:Drosophila_2:1632034_at:572:501; Interrogation_Position=1547; Antisense; GTCGTTAATTGCCTCTATATCCTTC
>probe:Drosophila_2:1632034_at:577:543; Interrogation_Position=1583; Antisense; GGATAACACGGTAGCCCTGTATGTT
>probe:Drosophila_2:1632034_at:304:371; Interrogation_Position=1613; Antisense; GAAGGCGCTACAGATTCTTTGCACA
>probe:Drosophila_2:1632034_at:362:149; Interrogation_Position=1666; Antisense; ACATCCCCAACTTTATGCTTTTCTT
>probe:Drosophila_2:1632034_at:145:53; Interrogation_Position=1680; Antisense; ATGCTTTTCTTGTACTCCTTTTTCA
>probe:Drosophila_2:1632034_at:376:141; Interrogation_Position=1704; Antisense; ACGGCTGTGCTTTTCCATGCGGGAA
>probe:Drosophila_2:1632034_at:34:341; Interrogation_Position=1756; Antisense; GCTACTACAAGTTTCTGCAGGCCAT
>probe:Drosophila_2:1632034_at:504:307; Interrogation_Position=1777; Antisense; CCATTTCGGGCGATCGACTGAGCAA
>probe:Drosophila_2:1632034_at:325:39; Interrogation_Position=1807; Antisense; ATCTGAGCGCCTTTGATGTATTCGG
>probe:Drosophila_2:1632034_at:3:107; Interrogation_Position=1883; Antisense; AGAAAAGTCATCGTTGCCGGCCTAC
>probe:Drosophila_2:1632034_at:186:283; Interrogation_Position=1916; Antisense; CTCCTGAGCCAGCAGTAGTCAATTT
>probe:Drosophila_2:1632034_at:141:701; Interrogation_Position=1938; Antisense; TTTTGATTTAGTCAGTCGCCTCCAC
>probe:Drosophila_2:1632034_at:533:687; Interrogation_Position=1973; Antisense; TATATATCTCCTAGTATCCGCGTTC
>probe:Drosophila_2:1632034_at:597:29; Interrogation_Position=2013; Antisense; ATACATACGTCAAGAGTCTCCCGCG

Paste this into a BLAST search page for me
GTCGTTAATTGCCTCTATATCCTTCGGATAACACGGTAGCCCTGTATGTTGAAGGCGCTACAGATTCTTTGCACAACATCCCCAACTTTATGCTTTTCTTATGCTTTTCTTGTACTCCTTTTTCAACGGCTGTGCTTTTCCATGCGGGAAGCTACTACAAGTTTCTGCAGGCCATCCATTTCGGGCGATCGACTGAGCAAATCTGAGCGCCTTTGATGTATTCGGAGAAAAGTCATCGTTGCCGGCCTACCTCCTGAGCCAGCAGTAGTCAATTTTTTTGATTTAGTCAGTCGCCTCCACTATATATCTCCTAGTATCCGCGTTCATACATACGTCAAGAGTCTCCCGCG

Full Affymetrix probeset data:

Annotations for 1632034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720