FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632039_at:

>probe:Drosophila_2:1632039_at:698:129; Interrogation_Position=1212; Antisense; ACCTTCTTGATCTGGGTGAATCGCC
>probe:Drosophila_2:1632039_at:648:633; Interrogation_Position=1232; Antisense; TCGCCAGGACCATGTGCACATTATG
>probe:Drosophila_2:1632039_at:280:273; Interrogation_Position=1250; Antisense; CATTATGTCCATGGCACAGTGCGGC
>probe:Drosophila_2:1632039_at:630:575; Interrogation_Position=1272; Antisense; GGCGACTTGGGCGATGTTTACAATC
>probe:Drosophila_2:1632039_at:237:665; Interrogation_Position=1290; Antisense; TACAATCGCCTTGTCAACGGTCTAA
>probe:Drosophila_2:1632039_at:590:585; Interrogation_Position=1321; Antisense; TGGAGAAGACGTTGGCCTTTGCCCG
>probe:Drosophila_2:1632039_at:333:289; Interrogation_Position=1344; Antisense; CGGCATCCGCGTTATGGAAACCTTA
>probe:Drosophila_2:1632039_at:50:681; Interrogation_Position=1356; Antisense; TATGGAAACCTTACGGCTTGCCCCA
>probe:Drosophila_2:1632039_at:12:189; Interrogation_Position=1471; Antisense; AACAGCAGCTGCAGGTACGCGGCAC
>probe:Drosophila_2:1632039_at:701:107; Interrogation_Position=1555; Antisense; AGCTTGGTTTCACCGAGTTCGAACT
>probe:Drosophila_2:1632039_at:81:539; Interrogation_Position=1580; Antisense; GGTCAAAACTCTGCAGGATGGCGTT
>probe:Drosophila_2:1632039_at:389:545; Interrogation_Position=1595; Antisense; GGATGGCGTTGTGACCCTGATTAAC
>probe:Drosophila_2:1632039_at:532:385; Interrogation_Position=1720; Antisense; GAACACTCACAGACGAACACTTAGA
>probe:Drosophila_2:1632039_at:7:165; Interrogation_Position=1771; Antisense; AAATAAATTTGTCCCTAGCCACAGA

Paste this into a BLAST search page for me
ACCTTCTTGATCTGGGTGAATCGCCTCGCCAGGACCATGTGCACATTATGCATTATGTCCATGGCACAGTGCGGCGGCGACTTGGGCGATGTTTACAATCTACAATCGCCTTGTCAACGGTCTAATGGAGAAGACGTTGGCCTTTGCCCGCGGCATCCGCGTTATGGAAACCTTATATGGAAACCTTACGGCTTGCCCCAAACAGCAGCTGCAGGTACGCGGCACAGCTTGGTTTCACCGAGTTCGAACTGGTCAAAACTCTGCAGGATGGCGTTGGATGGCGTTGTGACCCTGATTAACGAACACTCACAGACGAACACTTAGAAAATAAATTTGTCCCTAGCCACAGA

Full Affymetrix probeset data:

Annotations for 1632039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720