FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632045_at:

>probe:Drosophila_2:1632045_at:174:609; Interrogation_Position=487; Antisense; TGACCCTGATTGCTGGACTGGTTAT
>probe:Drosophila_2:1632045_at:624:705; Interrogation_Position=508; Antisense; TTATGGCCTATTCCGACAGTGTCTG
>probe:Drosophila_2:1632045_at:191:401; Interrogation_Position=522; Antisense; GACAGTGTCTGTCTCCCAAATAGAG
>probe:Drosophila_2:1632045_at:435:301; Interrogation_Position=613; Antisense; CCCAGCTGCTGATGGCCAGTTTATA
>probe:Drosophila_2:1632045_at:218:679; Interrogation_Position=636; Antisense; TAGTGGCCGTAAGCTAATCTGTGTA
>probe:Drosophila_2:1632045_at:380:115; Interrogation_Position=660; Antisense; AGCATTTTGGAGATGCCGCAATCCA
>probe:Drosophila_2:1632045_at:158:347; Interrogation_Position=706; Antisense; GCATCAGCTCGCACTATTAGCATTT
>probe:Drosophila_2:1632045_at:230:721; Interrogation_Position=738; Antisense; TTGCCGGTAATGGAGGCGACCTAAT
>probe:Drosophila_2:1632045_at:33:603; Interrogation_Position=778; Antisense; TGTTTACCCCTACTCAAGCTGAGTG
>probe:Drosophila_2:1632045_at:366:513; Interrogation_Position=800; Antisense; GTGATAAGCGATGCACCGCGGGATT
>probe:Drosophila_2:1632045_at:119:303; Interrogation_Position=815; Antisense; CCGCGGGATTGATTGGTCGTGAAAT
>probe:Drosophila_2:1632045_at:424:661; Interrogation_Position=852; Antisense; TAACTTATTTGCTACACAACCGCCT
>probe:Drosophila_2:1632045_at:118:663; Interrogation_Position=864; Antisense; TACACAACCGCCTACTCGTAAAGTA
>probe:Drosophila_2:1632045_at:170:679; Interrogation_Position=905; Antisense; TATAAGGAAGCGTTTCCGTACCAAT

Paste this into a BLAST search page for me
TGACCCTGATTGCTGGACTGGTTATTTATGGCCTATTCCGACAGTGTCTGGACAGTGTCTGTCTCCCAAATAGAGCCCAGCTGCTGATGGCCAGTTTATATAGTGGCCGTAAGCTAATCTGTGTAAGCATTTTGGAGATGCCGCAATCCAGCATCAGCTCGCACTATTAGCATTTTTGCCGGTAATGGAGGCGACCTAATTGTTTACCCCTACTCAAGCTGAGTGGTGATAAGCGATGCACCGCGGGATTCCGCGGGATTGATTGGTCGTGAAATTAACTTATTTGCTACACAACCGCCTTACACAACCGCCTACTCGTAAAGTATATAAGGAAGCGTTTCCGTACCAAT

Full Affymetrix probeset data:

Annotations for 1632045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720