Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632049_at:

>probe:Drosophila_2:1632049_at:725:371; Interrogation_Position=1026; Antisense; GAAGGTCACACTGTGGCACCATGTC
>probe:Drosophila_2:1632049_at:140:63; Interrogation_Position=1046; Antisense; ATGTCCGCATGATTTGGTCTGTCCT
>probe:Drosophila_2:1632049_at:222:401; Interrogation_Position=1072; Antisense; GACTTCGGGATCTGGCCGATCGAAC
>probe:Drosophila_2:1632049_at:627:691; Interrogation_Position=1133; Antisense; TTTGGGTAGCGACTTCTTGGCAGAC
>probe:Drosophila_2:1632049_at:304:109; Interrogation_Position=1192; Antisense; AGAAGGGTTCCCAATCCGATAGCTC
>probe:Drosophila_2:1632049_at:101:623; Interrogation_Position=1237; Antisense; TGCGTCCCACCTTGGTAAGGTCAAA
>probe:Drosophila_2:1632049_at:385:223; Interrogation_Position=1253; Antisense; AAGGTCAAAGCATGCCATCTGTCGG
>probe:Drosophila_2:1632049_at:14:573; Interrogation_Position=1276; Antisense; GGCTCTGCACAGAAAAGGGCACTCT
>probe:Drosophila_2:1632049_at:196:83; Interrogation_Position=1291; Antisense; AGGGCACTCTCCAAGAGGTTATCTT
>probe:Drosophila_2:1632049_at:689:685; Interrogation_Position=1310; Antisense; TATCTTCACGAAGTCCAAGCACGGA
>probe:Drosophila_2:1632049_at:664:393; Interrogation_Position=1333; Antisense; GAAAGTCTGCCTATTCTTGTGCAAA
>probe:Drosophila_2:1632049_at:708:449; Interrogation_Position=1374; Antisense; GATCGTTTACCTATGTCGCTGGGAC
>probe:Drosophila_2:1632049_at:383:379; Interrogation_Position=1434; Antisense; GAACCACCTGTTTTGGCGTAGTCTA
>probe:Drosophila_2:1632049_at:726:163; Interrogation_Position=1555; Antisense; AAATCGTTGCGGGTGGAGCTGAATT

Paste this into a BLAST search page for me
GAAGGTCACACTGTGGCACCATGTCATGTCCGCATGATTTGGTCTGTCCTGACTTCGGGATCTGGCCGATCGAACTTTGGGTAGCGACTTCTTGGCAGACAGAAGGGTTCCCAATCCGATAGCTCTGCGTCCCACCTTGGTAAGGTCAAAAAGGTCAAAGCATGCCATCTGTCGGGGCTCTGCACAGAAAAGGGCACTCTAGGGCACTCTCCAAGAGGTTATCTTTATCTTCACGAAGTCCAAGCACGGAGAAAGTCTGCCTATTCTTGTGCAAAGATCGTTTACCTATGTCGCTGGGACGAACCACCTGTTTTGGCGTAGTCTAAAATCGTTGCGGGTGGAGCTGAATT

Full Affymetrix probeset data:

Annotations for 1632049_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime