FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632051_at:

>probe:Drosophila_2:1632051_at:423:553; Interrogation_Position=3144; Antisense; GGAGCCGACGCTAGTGGACTTTATA
>probe:Drosophila_2:1632051_at:226:15; Interrogation_Position=3168; Antisense; ATGTTCCAAAGTGTTGGCCGGCAGC
>probe:Drosophila_2:1632051_at:434:301; Interrogation_Position=3192; Antisense; CCCGCCTCAAAGCATCTTGGATGAT
>probe:Drosophila_2:1632051_at:574:61; Interrogation_Position=3215; Antisense; ATGTGCAAATGGTACTCGACGAGGA
>probe:Drosophila_2:1632051_at:314:375; Interrogation_Position=3258; Antisense; GAAGATGTGGCGTCTGCTCATTTAC
>probe:Drosophila_2:1632051_at:622:283; Interrogation_Position=3271; Antisense; CTGCTCATTTACGAACTGGACGCCA
>probe:Drosophila_2:1632051_at:370:475; Interrogation_Position=3431; Antisense; GTTACTCTTACGGAACCTATGCGAT
>probe:Drosophila_2:1632051_at:31:621; Interrogation_Position=3479; Antisense; TGCTCCGGGAATTGTTGCGGCCAAA
>probe:Drosophila_2:1632051_at:217:623; Interrogation_Position=3494; Antisense; TGCGGCCAAATGTCCAGCTTTGTTT
>probe:Drosophila_2:1632051_at:697:691; Interrogation_Position=3512; Antisense; TTTGTTTTCTAAGCATCCGTCGCGT
>probe:Drosophila_2:1632051_at:165:305; Interrogation_Position=3528; Antisense; CCGTCGCGTGCAAGGGATTTACAAG
>probe:Drosophila_2:1632051_at:53:365; Interrogation_Position=3561; Antisense; GAATAGCGAGCGAGCCAATCGTGAA
>probe:Drosophila_2:1632051_at:236:663; Interrogation_Position=3605; Antisense; TAAATCCACCTTGTTAGCGTTAATT
>probe:Drosophila_2:1632051_at:200:163; Interrogation_Position=3679; Antisense; AAATTTACACCACCAGATGCAATAG

Paste this into a BLAST search page for me
GGAGCCGACGCTAGTGGACTTTATAATGTTCCAAAGTGTTGGCCGGCAGCCCCGCCTCAAAGCATCTTGGATGATATGTGCAAATGGTACTCGACGAGGAGAAGATGTGGCGTCTGCTCATTTACCTGCTCATTTACGAACTGGACGCCAGTTACTCTTACGGAACCTATGCGATTGCTCCGGGAATTGTTGCGGCCAAATGCGGCCAAATGTCCAGCTTTGTTTTTTGTTTTCTAAGCATCCGTCGCGTCCGTCGCGTGCAAGGGATTTACAAGGAATAGCGAGCGAGCCAATCGTGAATAAATCCACCTTGTTAGCGTTAATTAAATTTACACCACCAGATGCAATAG

Full Affymetrix probeset data:

Annotations for 1632051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720