FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632055_at:

>probe:Drosophila_2:1632055_at:239:269; Interrogation_Position=298; Antisense; CAGGCATTGATCACCAGTGCTCAGT
>probe:Drosophila_2:1632055_at:493:681; Interrogation_Position=328; Antisense; TATGGCTTGCCCGAGGAAACTAAAC
>probe:Drosophila_2:1632055_at:524:177; Interrogation_Position=344; Antisense; AAACTAAACTTGTGGCTGTGGCCGG
>probe:Drosophila_2:1632055_at:674:673; Interrogation_Position=410; Antisense; TAGCCAATTGGACCCATCATCCGAA
>probe:Drosophila_2:1632055_at:249:279; Interrogation_Position=435; Antisense; CTACGATCCCGTGACAGTTGACAAT
>probe:Drosophila_2:1632055_at:277:59; Interrogation_Position=458; Antisense; ATGATATAGGTGTCCTCCTTCTGGA
>probe:Drosophila_2:1632055_at:93:241; Interrogation_Position=510; Antisense; AATAAGCTCAATTGGTATCCGCCCG
>probe:Drosophila_2:1632055_at:359:121; Interrogation_Position=536; Antisense; AGCGTCCTGCAGTGGGTAGACTTGC
>probe:Drosophila_2:1632055_at:670:485; Interrogation_Position=551; Antisense; GTAGACTTGCCACTGTAGCCGGATG
>probe:Drosophila_2:1632055_at:106:397; Interrogation_Position=621; Antisense; GACCGAAGTTCCAGTGGTTAGCTCT
>probe:Drosophila_2:1632055_at:721:475; Interrogation_Position=637; Antisense; GTTAGCTCTGAGCAGTGCACACAAA
>probe:Drosophila_2:1632055_at:417:231; Interrogation_Position=660; Antisense; AATCTACGGAGCTGGCGAGGTTACC
>probe:Drosophila_2:1632055_at:686:399; Interrogation_Position=693; Antisense; GATTTGCGCGGGATTCGTAGTTCAA
>probe:Drosophila_2:1632055_at:641:647; Interrogation_Position=761; Antisense; TCATCGATGGTCAGCTGGTGGGTCT

Paste this into a BLAST search page for me
CAGGCATTGATCACCAGTGCTCAGTTATGGCTTGCCCGAGGAAACTAAACAAACTAAACTTGTGGCTGTGGCCGGTAGCCAATTGGACCCATCATCCGAACTACGATCCCGTGACAGTTGACAATATGATATAGGTGTCCTCCTTCTGGAAATAAGCTCAATTGGTATCCGCCCGAGCGTCCTGCAGTGGGTAGACTTGCGTAGACTTGCCACTGTAGCCGGATGGACCGAAGTTCCAGTGGTTAGCTCTGTTAGCTCTGAGCAGTGCACACAAAAATCTACGGAGCTGGCGAGGTTACCGATTTGCGCGGGATTCGTAGTTCAATCATCGATGGTCAGCTGGTGGGTCT

Full Affymetrix probeset data:

Annotations for 1632055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720