FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632059_at:

>probe:Drosophila_2:1632059_at:86:333; Interrogation_Position=205; Antisense; GCTGTTAGACTAACGCGATTTCCAT
>probe:Drosophila_2:1632059_at:384:695; Interrogation_Position=223; Antisense; TTTCCATTTATCGATTCACCTGCAG
>probe:Drosophila_2:1632059_at:506:617; Interrogation_Position=243; Antisense; TGCAGCCGAAGCCATTCCATTCCAT
>probe:Drosophila_2:1632059_at:622:719; Interrogation_Position=262; Antisense; TTCCATACCAGCATCATCGACTTAA
>probe:Drosophila_2:1632059_at:60:637; Interrogation_Position=278; Antisense; TCGACTTAATCCGTTCGAGCGGGAT
>probe:Drosophila_2:1632059_at:77:537; Interrogation_Position=352; Antisense; GGTCGCCGGCTCATTAAAAGCAGCT
>probe:Drosophila_2:1632059_at:627:183; Interrogation_Position=367; Antisense; AAAAGCAGCTGCCTAACGGTGCTCG
>probe:Drosophila_2:1632059_at:463:313; Interrogation_Position=377; Antisense; GCCTAACGGTGCTCGGCATTCGGTA
>probe:Drosophila_2:1632059_at:301:1; Interrogation_Position=394; Antisense; ATTCGGTACCGGTACTCGATACCAT
>probe:Drosophila_2:1632059_at:718:665; Interrogation_Position=406; Antisense; TACTCGATACCATCCGATACCGTTA
>probe:Drosophila_2:1632059_at:26:455; Interrogation_Position=421; Antisense; GATACCGTTACTCGGTACTCGGCTA
>probe:Drosophila_2:1632059_at:46:537; Interrogation_Position=434; Antisense; GGTACTCGGCTAACGACGACGATGA
>probe:Drosophila_2:1632059_at:106:207; Interrogation_Position=469; Antisense; AAGCGAATCCAGTAGTGCAAGCGAA
>probe:Drosophila_2:1632059_at:45:623; Interrogation_Position=56; Antisense; TCGCGTTCAAACTCGAAACTAAGGA

Paste this into a BLAST search page for me
GCTGTTAGACTAACGCGATTTCCATTTTCCATTTATCGATTCACCTGCAGTGCAGCCGAAGCCATTCCATTCCATTTCCATACCAGCATCATCGACTTAATCGACTTAATCCGTTCGAGCGGGATGGTCGCCGGCTCATTAAAAGCAGCTAAAAGCAGCTGCCTAACGGTGCTCGGCCTAACGGTGCTCGGCATTCGGTAATTCGGTACCGGTACTCGATACCATTACTCGATACCATCCGATACCGTTAGATACCGTTACTCGGTACTCGGCTAGGTACTCGGCTAACGACGACGATGAAAGCGAATCCAGTAGTGCAAGCGAATCGCGTTCAAACTCGAAACTAAGGA

Full Affymetrix probeset data:

Annotations for 1632059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720