Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632060_at:

>probe:Drosophila_2:1632060_at:173:45; Interrogation_Position=2884; Antisense; ATCGCAGCCGATCGATATACTCTAC
>probe:Drosophila_2:1632060_at:206:459; Interrogation_Position=2897; Antisense; GATATACTCTACTCGAAGATTGCCA
>probe:Drosophila_2:1632060_at:550:423; Interrogation_Position=2954; Antisense; GAGAACACCTTATAGCGACCACTTG
>probe:Drosophila_2:1632060_at:268:299; Interrogation_Position=2983; Antisense; CGCGGCTGGCTGGTGGAATCTAATC
>probe:Drosophila_2:1632060_at:269:565; Interrogation_Position=2997; Antisense; GGAATCTAATCATCAGCTCGCTGCG
>probe:Drosophila_2:1632060_at:357:303; Interrogation_Position=3033; Antisense; CCGCTCGCGACGATGATCGTGGATA
>probe:Drosophila_2:1632060_at:588:609; Interrogation_Position=3066; Antisense; TGAGCCAAACCATGAGTATTTCCTC
>probe:Drosophila_2:1632060_at:665:685; Interrogation_Position=3082; Antisense; TATTTCCTCGGCGTTGTACAACACT
>probe:Drosophila_2:1632060_at:81:267; Interrogation_Position=3154; Antisense; CAGTGTCATCGGCAGTGCTGTAAAG
>probe:Drosophila_2:1632060_at:323:729; Interrogation_Position=3183; Antisense; TTGTGAGTAGTGTTGGCAGCACCAA
>probe:Drosophila_2:1632060_at:31:391; Interrogation_Position=3209; Antisense; GAAACGGATGACTCGTGGAGCCCAT
>probe:Drosophila_2:1632060_at:65:521; Interrogation_Position=3223; Antisense; GTGGAGCCCATCGTAAATGTGCGCG
>probe:Drosophila_2:1632060_at:2:203; Interrogation_Position=3366; Antisense; AACCGTGACAGTGCTGGACAGCGAC
>probe:Drosophila_2:1632060_at:98:253; Interrogation_Position=3392; Antisense; CAAGCCACAAGATCGCTGCGGAGCG

Paste this into a BLAST search page for me
ATCGCAGCCGATCGATATACTCTACGATATACTCTACTCGAAGATTGCCAGAGAACACCTTATAGCGACCACTTGCGCGGCTGGCTGGTGGAATCTAATCGGAATCTAATCATCAGCTCGCTGCGCCGCTCGCGACGATGATCGTGGATATGAGCCAAACCATGAGTATTTCCTCTATTTCCTCGGCGTTGTACAACACTCAGTGTCATCGGCAGTGCTGTAAAGTTGTGAGTAGTGTTGGCAGCACCAAGAAACGGATGACTCGTGGAGCCCATGTGGAGCCCATCGTAAATGTGCGCGAACCGTGACAGTGCTGGACAGCGACCAAGCCACAAGATCGCTGCGGAGCG

Full Affymetrix probeset data:

Annotations for 1632060_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime